ID: 1175383619

View in Genome Browser
Species Human (GRCh38)
Location 20:58580337-58580359
Sequence CCTGCAGTCCCGGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175383619_1175383623 -7 Left 1175383619 20:58580337-58580359 CCAGCGGGGGCCGGGACTGCAGG No data
Right 1175383623 20:58580353-58580375 CTGCAGGCTAATTGGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175383619 Original CRISPR CCTGCAGTCCCGGCCCCCGC TGG (reversed) Intergenic
No off target data available for this crispr