ID: 1175384184

View in Genome Browser
Species Human (GRCh38)
Location 20:58583748-58583770
Sequence CCCTTGGAGTGCTGTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175384170_1175384184 26 Left 1175384170 20:58583699-58583721 CCCAGGGGAGCAGGAGCAGGGCG No data
Right 1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG No data
1175384171_1175384184 25 Left 1175384171 20:58583700-58583722 CCAGGGGAGCAGGAGCAGGGCGG No data
Right 1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG No data
1175384169_1175384184 27 Left 1175384169 20:58583698-58583720 CCCCAGGGGAGCAGGAGCAGGGC No data
Right 1175384184 20:58583748-58583770 CCCTTGGAGTGCTGTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175384184 Original CRISPR CCCTTGGAGTGCTGTGTCTG GGG Intergenic
No off target data available for this crispr