ID: 1175386769

View in Genome Browser
Species Human (GRCh38)
Location 20:58601384-58601406
Sequence GAGCCGATGCTTGTTGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175386767_1175386769 -10 Left 1175386767 20:58601371-58601393 CCGTATCCTCTGAGAGCCGATGC No data
Right 1175386769 20:58601384-58601406 GAGCCGATGCTTGTTGCCATTGG No data
1175386766_1175386769 18 Left 1175386766 20:58601343-58601365 CCAGCAGCGCAGGAGGGCTCTAA No data
Right 1175386769 20:58601384-58601406 GAGCCGATGCTTGTTGCCATTGG No data
1175386765_1175386769 22 Left 1175386765 20:58601339-58601361 CCTACCAGCAGCGCAGGAGGGCT No data
Right 1175386769 20:58601384-58601406 GAGCCGATGCTTGTTGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175386769 Original CRISPR GAGCCGATGCTTGTTGCCAT TGG Intergenic
No off target data available for this crispr