ID: 1175388005

View in Genome Browser
Species Human (GRCh38)
Location 20:58609421-58609443
Sequence CCTGAGGTTCAGAGAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175388005_1175388010 17 Left 1175388005 20:58609421-58609443 CCTGGACCTCTCTGAACCTCAGG No data
Right 1175388010 20:58609461-58609483 ATCATCATCCTCCTCACCTATGG No data
1175388005_1175388013 28 Left 1175388005 20:58609421-58609443 CCTGGACCTCTCTGAACCTCAGG No data
Right 1175388013 20:58609472-58609494 CCTCACCTATGGAGTTGTTGAGG No data
1175388005_1175388009 -7 Left 1175388005 20:58609421-58609443 CCTGGACCTCTCTGAACCTCAGG No data
Right 1175388009 20:58609437-58609459 CCTCAGGCTCATCACAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175388005 Original CRISPR CCTGAGGTTCAGAGAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr