ID: 1175388448

View in Genome Browser
Species Human (GRCh38)
Location 20:58611838-58611860
Sequence AGCCCCCGGCCAGAACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175388445_1175388448 0 Left 1175388445 20:58611815-58611837 CCTGGGGCAGGACTCTTGCCAAC No data
Right 1175388448 20:58611838-58611860 AGCCCCCGGCCAGAACCTGCAGG No data
1175388443_1175388448 14 Left 1175388443 20:58611801-58611823 CCAGAGAGCTGGAGCCTGGGGCA No data
Right 1175388448 20:58611838-58611860 AGCCCCCGGCCAGAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175388448 Original CRISPR AGCCCCCGGCCAGAACCTGC AGG Intergenic
No off target data available for this crispr