ID: 1175389002

View in Genome Browser
Species Human (GRCh38)
Location 20:58614630-58614652
Sequence TAGCCTCACCTGCTAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175389002_1175389012 25 Left 1175389002 20:58614630-58614652 CCCGTCTCTAGCAGGTGAGGCTA No data
Right 1175389012 20:58614678-58614700 TGCGTCCCTGGGTGCTCCAATGG No data
1175389002_1175389007 13 Left 1175389002 20:58614630-58614652 CCCGTCTCTAGCAGGTGAGGCTA No data
Right 1175389007 20:58614666-58614688 CTGCCTCACCCATGCGTCCCTGG No data
1175389002_1175389008 14 Left 1175389002 20:58614630-58614652 CCCGTCTCTAGCAGGTGAGGCTA No data
Right 1175389008 20:58614667-58614689 TGCCTCACCCATGCGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175389002 Original CRISPR TAGCCTCACCTGCTAGAGAC GGG (reversed) Intergenic
No off target data available for this crispr