ID: 1175390420

View in Genome Browser
Species Human (GRCh38)
Location 20:58623959-58623981
Sequence CACACTAATGAGACCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175390420_1175390424 -4 Left 1175390420 20:58623959-58623981 CCTGCTGGGGTCTCATTAGTGTG No data
Right 1175390424 20:58623978-58624000 TGTGCGGAGGGCGTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175390420 Original CRISPR CACACTAATGAGACCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr