ID: 1175391339

View in Genome Browser
Species Human (GRCh38)
Location 20:58629321-58629343
Sequence TGTCATCTGCAGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175391339_1175391347 21 Left 1175391339 20:58629321-58629343 CCAGCCAGCCTCTGCAGATGACA No data
Right 1175391347 20:58629365-58629387 CACCTGCTTTCTCACTGCTGGGG No data
1175391339_1175391346 20 Left 1175391339 20:58629321-58629343 CCAGCCAGCCTCTGCAGATGACA No data
Right 1175391346 20:58629364-58629386 CCACCTGCTTTCTCACTGCTGGG No data
1175391339_1175391344 19 Left 1175391339 20:58629321-58629343 CCAGCCAGCCTCTGCAGATGACA No data
Right 1175391344 20:58629363-58629385 GCCACCTGCTTTCTCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175391339 Original CRISPR TGTCATCTGCAGAGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr