ID: 1175391785

View in Genome Browser
Species Human (GRCh38)
Location 20:58632145-58632167
Sequence CATGGAGCTCCTTCTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175391785_1175391798 19 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391798 20:58632187-58632209 GAGGCGTGAGGACCACCAGGAGG No data
1175391785_1175391796 7 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391796 20:58632175-58632197 GGAGCAGGGCTGGAGGCGTGAGG No data
1175391785_1175391791 -7 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391791 20:58632161-58632183 CTCCATGCCAAGGAGGAGCAGGG No data
1175391785_1175391793 -3 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391793 20:58632165-58632187 ATGCCAAGGAGGAGCAGGGCTGG No data
1175391785_1175391797 16 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391797 20:58632184-58632206 CTGGAGGCGTGAGGACCACCAGG No data
1175391785_1175391795 0 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391795 20:58632168-58632190 CCAAGGAGGAGCAGGGCTGGAGG No data
1175391785_1175391790 -8 Left 1175391785 20:58632145-58632167 CCCCACTGAGAAGGAGCTCCATG No data
Right 1175391790 20:58632160-58632182 GCTCCATGCCAAGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175391785 Original CRISPR CATGGAGCTCCTTCTCAGTG GGG (reversed) Intergenic
No off target data available for this crispr