ID: 1175393721

View in Genome Browser
Species Human (GRCh38)
Location 20:58644185-58644207
Sequence CGGGACCTGCCACTGTGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175393711_1175393721 14 Left 1175393711 20:58644148-58644170 CCATGGGTAGAGTGTGTGCAGGA No data
Right 1175393721 20:58644185-58644207 CGGGACCTGCCACTGTGGTTAGG No data
1175393709_1175393721 15 Left 1175393709 20:58644147-58644169 CCCATGGGTAGAGTGTGTGCAGG No data
Right 1175393721 20:58644185-58644207 CGGGACCTGCCACTGTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175393721 Original CRISPR CGGGACCTGCCACTGTGGTT AGG Intergenic
No off target data available for this crispr