ID: 1175394044

View in Genome Browser
Species Human (GRCh38)
Location 20:58646458-58646480
Sequence CCCAACAGGCCCCACCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175394044_1175394051 -1 Left 1175394044 20:58646458-58646480 CCATTTAGGTGGGGCCTGTTGGG No data
Right 1175394051 20:58646480-58646502 GCAGGGCTTTGAATGCCCAGGGG No data
1175394044_1175394049 -3 Left 1175394044 20:58646458-58646480 CCATTTAGGTGGGGCCTGTTGGG No data
Right 1175394049 20:58646478-58646500 GGGCAGGGCTTTGAATGCCCAGG No data
1175394044_1175394055 15 Left 1175394044 20:58646458-58646480 CCATTTAGGTGGGGCCTGTTGGG No data
Right 1175394055 20:58646496-58646518 CCAGGGGGCACTCCGCCATGTGG No data
1175394044_1175394052 0 Left 1175394044 20:58646458-58646480 CCATTTAGGTGGGGCCTGTTGGG No data
Right 1175394052 20:58646481-58646503 CAGGGCTTTGAATGCCCAGGGGG No data
1175394044_1175394050 -2 Left 1175394044 20:58646458-58646480 CCATTTAGGTGGGGCCTGTTGGG No data
Right 1175394050 20:58646479-58646501 GGCAGGGCTTTGAATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175394044 Original CRISPR CCCAACAGGCCCCACCTAAA TGG (reversed) Intergenic
No off target data available for this crispr