ID: 1175396359

View in Genome Browser
Species Human (GRCh38)
Location 20:58665742-58665764
Sequence AAGCGTGGCACGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175396359_1175396366 8 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396366 20:58665773-58665795 TTGGGCTTAATCACGGCTCCTGG 0: 1
1: 0
2: 0
3: 4
4: 40
1175396359_1175396364 1 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396364 20:58665766-58665788 AGCACCGTTGGGCTTAATCACGG 0: 1
1: 0
2: 0
3: 0
4: 39
1175396359_1175396368 18 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396368 20:58665783-58665805 TCACGGCTCCTGGACGTGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1175396359_1175396367 17 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396367 20:58665782-58665804 ATCACGGCTCCTGGACGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 54
1175396359_1175396362 -10 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396362 20:58665755-58665777 TGCCACGCTTGAGCACCGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 11
1175396359_1175396370 30 Left 1175396359 20:58665742-58665764 CCTGCAGCATCCGTGCCACGCTT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1175396370 20:58665795-58665817 GACGTGCTGGGATTAGTGAATGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175396359 Original CRISPR AAGCGTGGCACGGATGCTGC AGG (reversed) Intronic
900316583 1:2060186-2060208 AGGCATGGCACGGATGCTGGAGG - Intronic
900957727 1:5897932-5897954 AAACATGGCACGGTTTCTGCAGG + Intronic
903177843 1:21591190-21591212 AAGGGAGCCACGGCTGCTGCTGG - Intergenic
917853769 1:179085776-179085798 CTTCGTGGCACGGATGCTGGTGG + Exonic
918471871 1:184883666-184883688 CCGAGTGGCACTGATGCTGCTGG - Intronic
919480264 1:198079540-198079562 AAGGTTGGCAGGGGTGCTGCTGG - Intergenic
1064271737 10:13871769-13871791 AAGCGTGGGAAGGAGGCTCCAGG + Intronic
1064902751 10:20312493-20312515 AAGCGTGGCTCGGAGGCCTCAGG + Intergenic
1068305397 10:55200883-55200905 AAGCATGGCAGGGAGGCTTCAGG - Intronic
1072048628 10:91681783-91681805 AAGAGTGGCAGGGATTTTGCAGG + Intergenic
1073248915 10:102109921-102109943 ATGCATGGCAAGGATGCTGCGGG + Exonic
1077499336 11:2902166-2902188 AACCGTGGCACGGGCGCTCCCGG + Intronic
1078266605 11:9759580-9759602 AGGCGGGGGACAGATGCTGCTGG + Intergenic
1078928622 11:15896119-15896141 AAGGCCGGCACGGAGGCTGCTGG + Intergenic
1082247239 11:49938717-49938739 AAGACTTGCACGGATGCTCCTGG - Intergenic
1088385566 11:109250847-109250869 AAGGGTGGCACAGATGGTGAAGG + Intergenic
1091458738 12:628125-628147 AAGCGGTGCAGGGATCCTGCAGG - Intronic
1092254577 12:6919436-6919458 AAGTGTGGCGGGGATGCTGTTGG - Intronic
1104717430 12:131025465-131025487 AACCGTGACATGGAGGCTGCAGG + Intronic
1114671833 14:24415608-24415630 AAGCGAGGCATGGAGGCCGCGGG - Exonic
1119215516 14:72866337-72866359 AAGTTTGGCACTGATCCTGCAGG - Intronic
1119698167 14:76730644-76730666 AAGTGTGGCATGGATGCAGCAGG + Intergenic
1122717775 14:103705819-103705841 AAGCCTGGCACGGAGGACGCTGG + Intronic
1123025543 14:105421963-105421985 ATGCCTGGCAGAGATGCTGCTGG + Intronic
1123122092 14:105921461-105921483 GAGCATGGCCCGGCTGCTGCAGG - Intronic
1123122102 14:105921503-105921525 GAGCATGGCCCGGCTGCTGCAGG - Intronic
1123404770 15:20013068-20013090 GAGCATGGCCCGGCTGCTGCAGG - Intergenic
1123514101 15:21019715-21019737 GAGCATGGCCCGGCTGCTGCAGG - Intergenic
1128370024 15:67033712-67033734 AAGCGTGCCCGGGACGCTGCTGG + Intergenic
1128455705 15:67830130-67830152 AACCGTGACCCGGATACTGCCGG - Intronic
1132994371 16:2815364-2815386 AAGCCTGGCCCGGGGGCTGCAGG - Intergenic
1133529668 16:6643034-6643056 CAGCGTGGCAGAGATGCTTCAGG - Intronic
1134404972 16:13948691-13948713 AAGCCTGGCATGGACGGTGCAGG + Exonic
1141135728 16:81463968-81463990 AAGCTTGGCAAGGAGGCTGAGGG - Intronic
1141815666 16:86407968-86407990 AAGTGTGGCAGGGAAACTGCAGG + Intergenic
1142245681 16:88969130-88969152 CAGCCTGGCCCGGATGCCGCCGG + Intronic
1143709907 17:8727001-8727023 AAGCGAGGAACGGATGCTGGAGG - Intergenic
1149570238 17:57667165-57667187 CAGCATGGCATGGGTGCTGCAGG + Intronic
1152571083 17:81121573-81121595 AAGCTTGCCACGGAGGCTGAGGG - Exonic
1153872734 18:9335113-9335135 AAGCGGCGCAGAGATGCTGCTGG - Intronic
1160176781 18:76601401-76601423 ATGCGTGTCTTGGATGCTGCTGG + Intergenic
1160847489 19:1173062-1173084 ACGCCGGGCACGGATGGTGCTGG - Intronic
1161011051 19:1959609-1959631 AAAGGTGGCACGGGTGCTGGGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
926244479 2:11113064-11113086 AAGTACGGCAAGGATGCTGCAGG + Intergenic
926764933 2:16316030-16316052 AAGCGGGAAAGGGATGCTGCTGG - Intergenic
938324638 2:130390456-130390478 GAGGCTGGCACGGTTGCTGCCGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
947770749 2:232668340-232668362 AGGTGTGACAGGGATGCTGCTGG + Intronic
948584821 2:239012665-239012687 AAGGGTGAGTCGGATGCTGCTGG + Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
1173690746 20:44959439-44959461 AAGCTTGGCATGAAAGCTGCTGG - Intronic
1175396359 20:58665742-58665764 AAGCGTGGCACGGATGCTGCAGG - Intronic
1176092098 20:63322723-63322745 AAGCGTGACACAGATGCCGAAGG + Intronic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1179601210 21:42478356-42478378 AAGGGTGACACCAATGCTGCAGG + Intronic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1180385466 22:12174453-12174475 GATTGTGGCAGGGATGCTGCTGG - Intergenic
1180967978 22:19800438-19800460 AAGCCTGGCAGGGATCCTGCAGG - Intronic
1184602976 22:45554394-45554416 AAGGTGGGCACGGGTGCTGCTGG - Intronic
952809366 3:37387525-37387547 ATGCCTGGCAGGGATGCAGCTGG + Intronic
954463410 3:50640552-50640574 AAGCGTGGCAGGGAGCCTGAGGG - Intronic
955000049 3:54919224-54919246 ATGCGTGGCACGAATGCAGTGGG - Intronic
961651571 3:128419214-128419236 AAGTGGGGCACGGCTGCTGGTGG + Intergenic
964101822 3:152996381-152996403 AAGAGTGGCACAGATACAGCAGG + Intergenic
968425849 4:522711-522733 AAGCGTGGCACAGATCATCCTGG - Intronic
968960383 4:3740254-3740276 AAGCGGGGCAGGGGTGCTGTGGG - Intergenic
969617577 4:8262575-8262597 AAGTGTGGCAGGGGTGCTGGGGG - Intergenic
970531930 4:16993770-16993792 AAGCCTTGCACAGAAGCTGCTGG + Intergenic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
985877446 5:2610621-2610643 AACTGTGGCATGGTTGCTGCTGG - Intergenic
990023598 5:51159447-51159469 AGCCGTGGCAGGGCTGCTGCAGG - Intergenic
990174344 5:53090626-53090648 AACCCTGGCTGGGATGCTGCCGG - Exonic
999770483 5:154771717-154771739 AAGCCAGGCACTGATCCTGCTGG + Intronic
1005216721 6:23537406-23537428 AAGCGTGGCTGGGATGCCTCAGG + Intergenic
1007763530 6:44148178-44148200 CAGCGTGGGCTGGATGCTGCAGG + Intronic
1011556721 6:88576987-88577009 AAGAGAGGCAGGGATACTGCAGG + Intergenic
1019387921 7:768977-768999 AGGCGTTGCACCGAAGCTGCTGG - Intronic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1020096886 7:5374408-5374430 AAGCGGGGCCTGGAGGCTGCGGG - Exonic
1023254097 7:38295742-38295764 CAGTGTGGCACTGATGCTGTGGG + Intergenic
1036103918 8:5819130-5819152 AAGAGTGGCTCGGGGGCTGCTGG + Intergenic
1037688090 8:21160946-21160968 AGGCTGGGCAGGGATGCTGCGGG - Intergenic
1042220524 8:66468753-66468775 AAGCATGGCAAGGATGTTTCTGG + Exonic
1042511732 8:69619551-69619573 ATGCCTGCCACAGATGCTGCAGG - Intronic
1042625051 8:70748538-70748560 AAGCGTGGGAGGGAGGCTGGTGG + Intronic
1043708088 8:83378388-83378410 AAGCATGGAATGGATGCTGAGGG - Intergenic
1048812789 8:138303882-138303904 AAGAGTGGCACAGAAGCTACTGG + Intronic
1062067570 9:134537057-134537079 GAGAGTGGCACGGGTGCAGCAGG + Intergenic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic