ID: 1175398912

View in Genome Browser
Species Human (GRCh38)
Location 20:58688272-58688294
Sequence TAAGAGATACACAATGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175398909_1175398912 -3 Left 1175398909 20:58688252-58688274 CCGGCTGGTGTCCTTGTTCTTAA 0: 1
1: 0
2: 2
3: 22
4: 206
Right 1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 225
1175398907_1175398912 3 Left 1175398907 20:58688246-58688268 CCACGCCCGGCTGGTGTCCTTGT 0: 1
1: 0
2: 6
3: 41
4: 606
Right 1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 225
1175398906_1175398912 6 Left 1175398906 20:58688243-58688265 CCACCACGCCCGGCTGGTGTCCT 0: 1
1: 3
2: 29
3: 261
4: 3180
Right 1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 225
1175398908_1175398912 -2 Left 1175398908 20:58688251-58688273 CCCGGCTGGTGTCCTTGTTCTTA 0: 1
1: 0
2: 2
3: 18
4: 290
Right 1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG 0: 1
1: 0
2: 1
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175398912 Original CRISPR TAAGAGATACACAATGAGGT AGG Intronic
901832234 1:11899466-11899488 TTAAAGCTAGACAATGAGGTCGG + Intergenic
903984792 1:27218810-27218832 TAAGAGATATACAGTGGGCTGGG - Intergenic
904288164 1:29466972-29466994 TTAGAGATAGGCAAAGAGGTAGG - Intergenic
906077376 1:43061993-43062015 TAACACAGACACAATGGGGTAGG - Intergenic
906164636 1:43677024-43677046 TCAGAGATACACACTGAAGTAGG - Intronic
906474921 1:46162917-46162939 TAAGAAATAAACAGTGCGGTCGG - Intronic
908163339 1:61433712-61433734 TAAGAGTTACACTTTGAAGTAGG + Intronic
908887255 1:68803804-68803826 AAAGACATAGACAATGTGGTGGG + Intergenic
909304683 1:74058600-74058622 TAACAGATACACAAATAGATAGG + Intronic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
911232254 1:95373734-95373756 AAAGAGATAGACAACGAGGGAGG - Intergenic
911493744 1:98603519-98603541 TTAGAGAAACACAATGATATTGG + Intergenic
912316718 1:108674169-108674191 TAATAGAAACACAATGGGCTGGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
918258463 1:182771671-182771693 GAAAAGATACACCATGAGGAGGG + Intergenic
918435293 1:184504814-184504836 TAAGAGGAACACAATAAGATTGG - Intronic
920004067 1:202819972-202819994 TAGGAGATACATAAGGAAGTAGG + Intergenic
920230203 1:204465195-204465217 TAAGAGTTAAAGAATGGGGTGGG - Intronic
920814529 1:209318889-209318911 GAAGAGATACAAATAGAGGTGGG - Intergenic
921663500 1:217837282-217837304 TAATACATACACAATTAGCTGGG - Intronic
921669074 1:217906616-217906638 TAAAAGATACAGAAGCAGGTAGG + Intergenic
923489320 1:234469771-234469793 TAGGAGATACACAATGAAGCTGG - Intronic
1065580650 10:27167974-27167996 TAAGAGATACTAAAGGTGGTAGG + Intronic
1065730858 10:28708361-28708383 AAAGACATACACAAAGAGGTCGG + Intergenic
1070043569 10:72806949-72806971 TCAGAGTTACAAAATAAGGTTGG + Intronic
1071779005 10:88821928-88821950 ACAGAGCTATACAATGAGGTAGG - Intergenic
1071893769 10:90041765-90041787 TAACACATACCCACTGAGGTAGG - Intergenic
1072293044 10:93983069-93983091 TAAAAGAAAGACAATAAGGTGGG - Intergenic
1075935228 10:126334842-126334864 TAAGACATACACAGTGAAGAGGG + Intronic
1076444406 10:130502164-130502186 TTAGAGACACACATAGAGGTGGG - Intergenic
1078554954 11:12317039-12317061 AAAGAGAAACTCTATGAGGTTGG - Intronic
1079104928 11:17564484-17564506 TATGAGAAAAACAACGAGGTTGG + Intronic
1079502214 11:21114206-21114228 TAAGGGATATAGAAAGAGGTGGG - Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1086076668 11:82861844-82861866 CAAGATATACACAATGATGTAGG + Intronic
1086644052 11:89196998-89197020 TAATTGATATAAAATGAGGTAGG + Intronic
1087951833 11:104230248-104230270 TAATAGATACATATTGAAGTGGG + Intergenic
1089908355 11:122069369-122069391 TAAGAGTTGAATAATGAGGTGGG + Intergenic
1090087005 11:123659099-123659121 TAAGAGACACACAATGATCTTGG + Intergenic
1093002285 12:14010979-14011001 TAAAAGAAACATTATGAGGTTGG + Intergenic
1093524353 12:20090455-20090477 TAAGGGATACACAGGAAGGTGGG + Intergenic
1094392761 12:29970610-29970632 TAAGCGATGCACAATTATGTGGG + Intergenic
1095796187 12:46221351-46221373 TAAGAAATACTAGATGAGGTTGG - Intronic
1100501863 12:95182134-95182156 TTAGAAATAAATAATGAGGTTGG + Intronic
1101538206 12:105640063-105640085 TAAGAGAGACACAATAAGGCAGG - Intergenic
1103749398 12:123149373-123149395 AGAGAGAAACACAATGAGTTAGG - Intronic
1105737903 13:23290393-23290415 TAAGGGACAGACAATGCGGTGGG + Intronic
1106244754 13:27939685-27939707 TAAGAGTTTAACAATTAGGTTGG - Intergenic
1106716761 13:32397901-32397923 TAAAAGATAAAAAAGGAGGTAGG - Intronic
1107276155 13:38681626-38681648 TGAGAAATACACAATGGAGTTGG + Intergenic
1108012514 13:46033728-46033750 TATGAAATACACAATGTGCTGGG + Intronic
1109442408 13:62393162-62393184 TAAGAAATACACTAATAGGTAGG - Intergenic
1110473312 13:75884955-75884977 TAAAAGATACAAAATGATATGGG + Intergenic
1111583007 13:90249460-90249482 TTTGAAATACACAATAAGGTCGG + Intergenic
1111926475 13:94468741-94468763 TTAGAGATACATTATTAGGTGGG - Exonic
1112438341 13:99407653-99407675 TAAGAAATACAAAATTAGGCCGG - Intergenic
1116530168 14:45961625-45961647 TAAAAGATATATAATTAGGTTGG - Intergenic
1116890082 14:50259504-50259526 AAAGAAATACACATTGAGGCCGG - Intronic
1117079395 14:52136124-52136146 AAAAAGATACAAAATGAGGGGGG + Intergenic
1119517194 14:75257552-75257574 TCAGAGATAGACAATGGGATTGG + Intronic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1120568973 14:86093986-86094008 TAAAAGATAAACAATGAGGGAGG - Intergenic
1120620595 14:86759076-86759098 AAAGAAATAAACAATGATGTTGG - Intergenic
1120939532 14:89934044-89934066 GAAGTGATACAAGATGAGGTTGG + Intronic
1121611814 14:95286232-95286254 TAAGTCCTAGACAATGAGGTGGG + Intronic
1123473466 15:20571194-20571216 TCAGGGTTACACAATGAGGGTGG + Intergenic
1123644543 15:22429159-22429181 TCAGGGTTACACAATGAGGGTGG - Intergenic
1123733763 15:23166205-23166227 TCAGGGTTACACAATGAGGGTGG + Intergenic
1123751894 15:23363580-23363602 TCAGGGTTACACAATGAGGGTGG + Intronic
1124155887 15:27225023-27225045 TCAGAGCAACAGAATGAGGTGGG - Intronic
1124284260 15:28387504-28387526 TCAGGGTTACACAATGAGGGTGG + Intronic
1124298437 15:28524110-28524132 TCAGGGTTACACAATGAGGGTGG - Intronic
1124505213 15:30266794-30266816 TAAAAGATACAGAATGGGGCCGG + Intergenic
1124738339 15:32271841-32271863 TAAAAGATACAGAATGGGGCCGG - Intergenic
1125269907 15:37927361-37927383 TAAGAGATACACACTGAAGAGGG + Intronic
1126492812 15:49258500-49258522 TAACAGTGACACAATGAAGTAGG + Intronic
1126773152 15:52077541-52077563 TAAAAGATACACAATGGACTTGG + Intergenic
1127104453 15:55598067-55598089 GAAGTGGTACAGAATGAGGTTGG - Intergenic
1127236818 15:57062284-57062306 TAAGAGATATTCTATGAGTTTGG - Intronic
1127590526 15:60417769-60417791 TAAGAGTTACATGAAGAGGTAGG - Intergenic
1127609249 15:60621166-60621188 TCAGAGATACACAATACAGTGGG - Intronic
1127945567 15:63747818-63747840 CAAGATCTACACAATAAGGTCGG + Exonic
1128925968 15:71656476-71656498 AGAGAGATACATAATGGGGTTGG + Intronic
1129338252 15:74867090-74867112 TAAGAAATACTCACTGAGGCTGG - Intronic
1130604644 15:85305230-85305252 GAAGAGAGAAACAGTGAGGTAGG - Intergenic
1130892372 15:88144077-88144099 TTAGAGATAAAGAATGAAGTAGG - Intronic
1136664761 16:31800334-31800356 TAAGACATGCACACAGAGGTGGG + Intergenic
1139194650 16:64905098-64905120 CAAGAGAAACACACTGAGGGTGG + Intergenic
1140500621 16:75430869-75430891 TCAGAGACATACAATGAGGCAGG + Intronic
1140725962 16:77812435-77812457 TATGGGATACACAATAAGGAAGG + Intronic
1147380106 17:40049851-40049873 AAAGAGATACACATTCAGGCTGG + Intronic
1148756993 17:49978433-49978455 AAAGAGAAACACTATGGGGTCGG - Intergenic
1149470178 17:56909989-56910011 TAAGAACAACACTATGAGGTAGG + Intronic
1150783890 17:68147028-68147050 CAAAAAATACAAAATGAGGTGGG + Intergenic
1151731909 17:75916457-75916479 TAAAAAATACACAATTAGCTGGG + Intronic
1153222044 18:2870570-2870592 TAAGAGAAACACAACGTGCTGGG + Intronic
1153392695 18:4580241-4580263 TAAGAACAACAAAATGAGGTAGG + Intergenic
1153814103 18:8778513-8778535 TTAGAGAGACACAATGAGTCGGG + Intronic
1154509180 18:15077050-15077072 TAAGAGACACTCAATGAGGCTGG - Intergenic
1155865426 18:30959282-30959304 TAAGAGATTCATAATAAGCTAGG + Intergenic
1160214937 18:76920388-76920410 TAAAAAATACAAAATTAGGTGGG + Intronic
1161717780 19:5886526-5886548 AAAGAGATACACAGGGAGGAAGG + Intronic
1164926236 19:32132133-32132155 TATGAGATACCCCATGAGGTAGG + Intergenic
1164926249 19:32132203-32132225 TATGAGATAGCCCATGAGGTAGG + Intergenic
1164926285 19:32132413-32132435 TATGAGATACCTCATGAGGTAGG + Intergenic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165476906 19:36035912-36035934 AAAGAGAGACACAGGGAGGTGGG + Intronic
1166325077 19:42044652-42044674 TAAAATATACACAATGAGCCAGG + Intronic
1167110599 19:47458375-47458397 GAAGAGAGACAGAAAGAGGTGGG - Intronic
925887354 2:8404277-8404299 TAGGTGATACACAAAGAGGGAGG - Intergenic
925958948 2:8996804-8996826 TAAGAGATACAGATTGAAGTAGG - Intronic
931913241 2:66925156-66925178 TAACAGATACACAGTGGGCTTGG + Intergenic
932768505 2:74486730-74486752 TAAAAGATACAAAATTAGCTGGG + Intronic
933400618 2:81792297-81792319 TAAGAGAAACACTATCAGTTTGG - Intergenic
933607157 2:84395307-84395329 TAAGAGAGACACAGGCAGGTGGG - Intergenic
934868028 2:97831500-97831522 TAAAAGATACACACATAGGTAGG + Intronic
935495293 2:103773525-103773547 TAAAATACACACAATGAAGTAGG + Intergenic
937146091 2:119646126-119646148 TAAACAATACACAAGGAGGTGGG + Intronic
938603520 2:132867820-132867842 ACAGAGATCCATAATGAGGTGGG - Intronic
941348281 2:164397720-164397742 TATGAGACACACATTGAGGGAGG - Intergenic
941470388 2:165878498-165878520 TAAGATATACAAAATGATGTCGG + Intronic
942241656 2:173967798-173967820 TAAGAGATACATATGGAGGTAGG + Intergenic
942546222 2:177066967-177066989 TAAGAGATACAAAAGCATGTTGG + Intergenic
942622906 2:177867175-177867197 TAAGGGACACACAATAAAGTTGG + Intronic
942910445 2:181237255-181237277 TTAGAGGTACACAAGGAGTTTGG + Intergenic
943236537 2:185328234-185328256 TAAGAGATACAAAATTGGCTGGG - Intergenic
945196305 2:207240517-207240539 TAAGAGAGAGACAGAGAGGTTGG + Intergenic
945263225 2:207863984-207864006 TAAGAAATAGAAAATGAGTTTGG - Intronic
945263454 2:207866611-207866633 TAAGAAATACGAAATGAGTTTGG - Intronic
945282777 2:208051614-208051636 CAAAAGCTACAAAATGAGGTGGG - Intergenic
946717965 2:222573101-222573123 TAGGAAATACAGAATCAGGTTGG + Intronic
947086998 2:226464750-226464772 TAAAAGATATACAATTAGGAGGG + Intergenic
947361834 2:229353299-229353321 ACAGAGATACACAATGATGAAGG + Intergenic
1169892289 20:10466321-10466343 ACAGAGACACACAATGAGGTAGG - Intronic
1170054140 20:12180574-12180596 GAAAAGATAAACACTGAGGTGGG - Intergenic
1171125811 20:22601099-22601121 TGAGAGATAGGTAATGAGGTTGG + Intergenic
1174576462 20:51541404-51541426 CCAGAAATACACAGTGAGGTTGG + Intronic
1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG + Intronic
1176788890 21:13294764-13294786 TAAGAGACACTCAATGAGGGTGG + Intergenic
1176993285 21:15523598-15523620 TAAATGATACAGAATGAGGAAGG + Intergenic
1177589886 21:23149411-23149433 TAAAAAATATACAATTAGGTAGG - Intergenic
1177988053 21:28002904-28002926 TAAGAGACACTCAATGAGGCTGG + Intergenic
1179201265 21:39223797-39223819 TAAAAGATTAAGAATGAGGTAGG + Intronic
1180239768 21:46494208-46494230 TAAGAGCTACACATTGCAGTTGG + Intronic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1182536642 22:31008669-31008691 TTAGAGATACACAGAGAGGAAGG + Intergenic
1182986419 22:34722149-34722171 TTAGAGACAAACAATGAAGTCGG - Intergenic
1185229977 22:49674252-49674274 TAAAAGAGACACAAAGAGGCTGG + Intergenic
953369311 3:42373651-42373673 TAAGACATGCACAATCAGGAAGG + Intergenic
955365996 3:58310634-58310656 TAAGAAATACAGAAAGAGGCCGG + Intronic
956820936 3:72953612-72953634 TAACAGATAAACAATGAGAGTGG - Intronic
957609665 3:82450806-82450828 TAACATATACATAATGAGGTTGG - Intergenic
957825728 3:85440488-85440510 TAACAAATACACTACGAGGTTGG + Intronic
959853348 3:111117364-111117386 TAATAGTTTCACATTGAGGTAGG + Intronic
960403650 3:117233665-117233687 TAAGAGTGACACAATTATGTGGG - Intergenic
961505791 3:127369866-127369888 TAAGAGATGCCCAGTGAGGGTGG - Intergenic
962872291 3:139507924-139507946 TCTCAGATACACAATCAGGTTGG - Intergenic
963235255 3:142949302-142949324 AAACAGATAGACAGTGAGGTAGG + Intronic
963322354 3:143822572-143822594 TAACAGATACAGCCTGAGGTAGG - Intronic
963327211 3:143875909-143875931 TAAGACATATACAAGAAGGTTGG - Intergenic
964830974 3:160884200-160884222 TAAGAGATATACAATGTGATTGG + Intronic
965943109 3:174209218-174209240 TAGGAAATACAGAATTAGGTCGG - Intronic
966646401 3:182250515-182250537 TAAGAGAGAAAGAATAAGGTGGG - Intergenic
967999101 3:195190196-195190218 TAAGAAATACTAAATGAGGCTGG + Intronic
970175012 4:13330756-13330778 TAAGAGATTTATTATGAGGTTGG - Intergenic
970207012 4:13665253-13665275 TAAGAAAGACACTATGGGGTGGG - Intergenic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970980458 4:22090476-22090498 TTAGAGATAAAGAAAGAGGTAGG + Intergenic
971014625 4:22475434-22475456 TAAGAATGACACAATGAGGCCGG + Intronic
971414861 4:26415484-26415506 TAAGATATACACAAGGAGGTGGG - Exonic
973023432 4:45233955-45233977 TAAGAAATACACAAACAGGCAGG - Intergenic
974388972 4:61239976-61239998 TAAGACAATCCCAATGAGGTAGG - Intronic
975172433 4:71247509-71247531 TCAGAGATGGACAATGTGGTTGG + Intronic
975700562 4:77062135-77062157 CAAGAGATACATAATAAGGCAGG - Intronic
976559148 4:86480941-86480963 TAACAGTAACACAATGAGGCAGG + Intronic
981398072 4:144278044-144278066 TTAGAGATCCACAAGAAGGTAGG + Intergenic
982051149 4:151503630-151503652 TAAGAGAAAGAGAATGAGTTGGG - Intronic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
986444871 5:7812598-7812620 TAACTGAAACCCAATGAGGTAGG + Intronic
986793003 5:11181538-11181560 GAACAGATACACAAAGAAGTCGG + Intronic
987867635 5:23566433-23566455 AAACATATACACAATGAGTTTGG - Intergenic
988791756 5:34614859-34614881 TAAAAGATAAACAATGAAGCTGG - Intergenic
989112836 5:37923862-37923884 GAAGAGGTAGAAAATGAGGTTGG - Intergenic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
991900422 5:71454896-71454918 TAAAAAGTACACAAGGAGGTTGG + Intergenic
992388173 5:76305882-76305904 TAAGGGACACAAAAAGAGGTGGG + Intronic
993839245 5:92856560-92856582 TAAGAGATAAAAGATGAGGGTGG + Intergenic
998466224 5:142346370-142346392 TTAGAAATGCAAAATGAGGTGGG + Intergenic
998666204 5:144300706-144300728 TAATTGATATACAATGTGGTTGG + Intronic
999386710 5:151158559-151158581 TAAGAGGGACCCAATCAGGTGGG + Intergenic
1000561860 5:162799227-162799249 TAAGAGCTACACAATTAGTGAGG - Intergenic
1000946754 5:167431297-167431319 GAAGAGATACAAAATGACTTAGG + Intronic
1001164060 5:169347481-169347503 TAAAAGATGAACAATGAGGTTGG - Intergenic
1003695157 6:8398470-8398492 TAAGAGAGACAAAATGACCTAGG + Intergenic
1004879478 6:19993106-19993128 TAAGAGATTTGCAATGAAGTCGG + Intergenic
1004989975 6:21125885-21125907 GGGGAGACACACAATGAGGTCGG - Intronic
1005616420 6:27577526-27577548 TAAAAGATACAGAAAGAGGCCGG + Intergenic
1005669459 6:28090697-28090719 TAATAGTTACAAAATGAGATAGG - Intergenic
1009320043 6:62276967-62276989 TAATAACTACACAATAAGGTTGG + Intronic
1011316076 6:86032766-86032788 TAAGATATACACAATTGGCTGGG - Intergenic
1012819790 6:104071521-104071543 TCAGATATACACAATCAGGAAGG - Intergenic
1013036671 6:106391742-106391764 AAAGAAATACACAATGACTTTGG + Intergenic
1013523996 6:110958101-110958123 TAAGAGATACACATTGTTATAGG - Intergenic
1013835468 6:114330028-114330050 TAAGAGATGCACAGTCCGGTGGG + Intronic
1014940929 6:127437722-127437744 TAAGAGATACAGCCTGAGGTAGG - Intergenic
1016004235 6:139073113-139073135 TAAGAGATATTCAAAGGGGTTGG - Intergenic
1016312982 6:142754545-142754567 TAAGAGATACTCAATGCAGAAGG + Intronic
1019367810 7:644338-644360 CTGGAGGTACACAATGAGGTGGG + Intronic
1019835993 7:3384196-3384218 TAAGAAATACATAATAAAGTTGG - Intronic
1020570114 7:9850403-9850425 GTTGAGATACACAATGTGGTCGG + Intergenic
1020992307 7:15214914-15214936 CAAGAGATACAAAAAGATGTAGG - Intronic
1022328061 7:29351146-29351168 TAAGAGATAGATTATGAGATAGG + Intronic
1026443322 7:70462350-70462372 TGATAGATACATAATGAGCTGGG + Intronic
1026498717 7:70924822-70924844 TAACATATACACCATGAGGCTGG - Intergenic
1029164814 7:98580275-98580297 TAAAAGATACTTACTGAGGTCGG - Intergenic
1031235568 7:119171599-119171621 TAAGAGATACAAATTCTGGTGGG - Intergenic
1031912731 7:127534604-127534626 AAAGAGACCCTCAATGAGGTCGG + Intergenic
1032281900 7:130510425-130510447 AAAGAGATACAGAATATGGTAGG + Intronic
1032740206 7:134730920-134730942 CAATAGATGAACAATGAGGTAGG - Intergenic
1033356668 7:140606016-140606038 AAAGATATATACAAAGAGGTTGG - Intronic
1034185170 7:149170440-149170462 TAAAAGATACAAAATGAGCTGGG + Intronic
1035341260 7:158164057-158164079 TACGAGTTACACAATGTGCTTGG - Intronic
1036101210 8:5787563-5787585 TAAGAGAATAACAATGAAGTAGG + Intergenic
1037223292 8:16552679-16552701 AAAGAGAAACCCAATGAGATAGG + Intronic
1037371301 8:18182107-18182129 GAAGAGATACACACTGAAGAAGG - Intronic
1039209329 8:35194707-35194729 TTAGAAATAAATAATGAGGTGGG + Intergenic
1040816134 8:51510477-51510499 AAAGAAATAGACACTGAGGTTGG + Intronic
1042565855 8:70110730-70110752 TAAGAGATACACATAGGGGGAGG + Exonic
1043163654 8:76875920-76875942 TAAGAGATAAAAAATCATGTAGG + Intergenic
1043719603 8:83530963-83530985 TAAAAAATACAAAATGAGCTGGG + Intergenic
1043731648 8:83691320-83691342 TAATACATACAAAATGGGGTAGG - Intergenic
1044387486 8:91606738-91606760 TAAGAGAAAGACAGTGAGGGAGG + Intergenic
1045412848 8:101936285-101936307 TAAGAGAGACTGAATGTGGTTGG - Intronic
1048236391 8:132694941-132694963 AAAGAGATATAAAATGAGTTTGG + Intronic
1048667830 8:136683892-136683914 TAAGAGATACCAAATTAGGCAGG - Intergenic
1049026970 8:139998421-139998443 TAAAAGATACACAATGGACTGGG + Intronic
1049122575 8:140752557-140752579 TTAGAGATACACCATGTGGCTGG + Intronic
1050026960 9:1345024-1345046 AAAGAGATAAACTATGAAGTGGG - Intergenic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1055136254 9:72832298-72832320 TCAGAGATTCACAGAGAGGTGGG - Intronic
1058374186 9:104304605-104304627 TAAGAAATAAACAATAAGGAGGG + Intergenic
1059930997 9:119260811-119260833 TAATAGAAAAACAATGGGGTGGG + Intronic
1185890902 X:3821071-3821093 TAAAAAATAGACAAGGAGGTCGG - Intronic
1188509849 X:30923885-30923907 TAAAAGATAAACTATGAGGCCGG + Intronic
1190026415 X:46927708-46927730 TTTGAGAAACACATTGAGGTCGG + Intronic
1194553812 X:95332998-95333020 TAAGAGAAAGACCATCAGGTGGG - Intergenic
1196017823 X:110958206-110958228 AAAGTGATGCTCAATGAGGTCGG + Intronic
1198435786 X:136615712-136615734 TAAGAGAATTACAATGAGGGAGG - Intergenic