ID: 1175399529

View in Genome Browser
Species Human (GRCh38)
Location 20:58692728-58692750
Sequence GAGACGTGCAGGGCCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 169}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175399529_1175399535 -2 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399535 20:58692749-58692771 TCGCGAGCAGCCCGGAGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 87
1175399529_1175399534 -5 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399534 20:58692746-58692768 GTCTCGCGAGCAGCCCGGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 52
1175399529_1175399539 4 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399539 20:58692755-58692777 GCAGCCCGGAGCGGCGGGGGAGG 0: 1
1: 1
2: 9
3: 79
4: 589
1175399529_1175399538 1 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399538 20:58692752-58692774 CGAGCAGCCCGGAGCGGCGGGGG 0: 1
1: 1
2: 1
3: 18
4: 211
1175399529_1175399533 -10 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399533 20:58692741-58692763 TGCACGTCTCGCGAGCAGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 32
1175399529_1175399545 16 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399545 20:58692767-58692789 GGCGGGGGAGGCGGGGCCCGCGG 0: 1
1: 2
2: 38
3: 286
4: 2065
1175399529_1175399536 -1 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399536 20:58692750-58692772 CGCGAGCAGCCCGGAGCGGCGGG 0: 1
1: 0
2: 0
3: 19
4: 150
1175399529_1175399549 29 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399549 20:58692780-58692802 GGGCCCGCGGGCTGCCGGGCAGG 0: 1
1: 0
2: 4
3: 78
4: 615
1175399529_1175399537 0 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399537 20:58692751-58692773 GCGAGCAGCCCGGAGCGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 194
1175399529_1175399548 25 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399548 20:58692776-58692798 GGCGGGGCCCGCGGGCTGCCGGG 0: 1
1: 1
2: 8
3: 66
4: 595
1175399529_1175399546 17 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399546 20:58692768-58692790 GCGGGGGAGGCGGGGCCCGCGGG 0: 1
1: 1
2: 17
3: 159
4: 1099
1175399529_1175399544 9 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399544 20:58692760-58692782 CCGGAGCGGCGGGGGAGGCGGGG 0: 1
1: 2
2: 9
3: 91
4: 839
1175399529_1175399550 30 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399550 20:58692781-58692803 GGCCCGCGGGCTGCCGGGCAGGG 0: 1
1: 0
2: 0
3: 37
4: 330
1175399529_1175399540 7 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399540 20:58692758-58692780 GCCCGGAGCGGCGGGGGAGGCGG 0: 1
1: 0
2: 9
3: 108
4: 935
1175399529_1175399547 24 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399547 20:58692775-58692797 AGGCGGGGCCCGCGGGCTGCCGG 0: 1
1: 0
2: 5
3: 62
4: 465
1175399529_1175399542 8 Left 1175399529 20:58692728-58692750 CCCGGGCGGGCCCTGCACGTCTC 0: 1
1: 0
2: 3
3: 15
4: 169
Right 1175399542 20:58692759-58692781 CCCGGAGCGGCGGGGGAGGCGGG 0: 1
1: 0
2: 8
3: 73
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175399529 Original CRISPR GAGACGTGCAGGGCCCGCCC GGG (reversed) Exonic
900228314 1:1543190-1543212 GAGACATGCAGGGCCCACTGGGG + Intronic
900341228 1:2190327-2190349 GAGAGGTGCAGGGGCCGCGTGGG - Intronic
900593106 1:3468534-3468556 GAGAGGTGCGGAGCCCACCCAGG - Intronic
900699281 1:4034107-4034129 GAGACGTACAGGGCCAGGCATGG + Intergenic
902189773 1:14754176-14754198 GACAGCTGCAGGGCCCACCCTGG + Intronic
902375530 1:16028448-16028470 GAGATGCACATGGCCCGCCCCGG + Intronic
903028159 1:20444265-20444287 CAGCCCTGCAGGGCCAGCCCAGG + Intergenic
903328294 1:22583851-22583873 GAGACTTGCAGGGCCAGCCGTGG + Intronic
904496142 1:30887844-30887866 GAGAAGAGCAGGGCCTGCCTTGG - Intronic
906062633 1:42958507-42958529 GAGAGGCGCGCGGCCCGCCCCGG + Intronic
906614574 1:47225585-47225607 CAGACCTCCCGGGCCCGCCCCGG - Exonic
919668254 1:200313586-200313608 GAGATGTTCAGGGCCCTTCCTGG + Intergenic
919781978 1:201226999-201227021 GTGCCGTGCAGGGCTCGCCCCGG + Exonic
919793436 1:201307119-201307141 GAGACCAGCAGTGCCCACCCAGG - Intronic
920886884 1:209938158-209938180 GAGAGGGGCGGGGCCCGGCCCGG - Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
922476480 1:225910285-225910307 GACACATTCAGGGCCAGCCCTGG - Intronic
1062859964 10:803406-803428 GAGACGTGGAGGGTCCACCTAGG + Intergenic
1064552851 10:16520748-16520770 AAGGCCTGCCGGGCCCGCCCGGG - Exonic
1067749313 10:48959749-48959771 GAGACGTGCAGCTCCCTCCCTGG + Exonic
1067828930 10:49598778-49598800 GAGACCAGCAGGGCCAGGCCTGG - Intergenic
1069909999 10:71753104-71753126 GAGCTGTGCAGGGCCCTCCTGGG - Intronic
1070752587 10:78972938-78972960 CAGACCTCCAGGGCCCGGCCTGG - Intergenic
1070896037 10:79983456-79983478 GGGACATGCAGGGACTGCCCGGG - Intergenic
1073110575 10:101061169-101061191 GGGTCGGGCAGGCCCCGCCCCGG - Intergenic
1076500647 10:130933578-130933600 GAGTTGTGCAGGGCCCACCCTGG - Intergenic
1076554111 10:131311223-131311245 GGGCCGGGCAGGGCGCGCCCAGG + Intronic
1076792702 10:132785568-132785590 GCGTGGTGCAGGGCGCGCCCTGG - Exonic
1077194436 11:1272261-1272283 GAGAGGAGCAGGGCCGGTCCTGG - Intergenic
1080409331 11:32009063-32009085 CAGAAATGCAGGGGCCGCCCAGG + Intronic
1082004448 11:47412018-47412040 TACACGTGCAGCGCCAGCCCTGG + Exonic
1084171808 11:67404522-67404544 GAGACGTACAGAGGCCTCCCCGG - Intronic
1092112148 12:5971366-5971388 GAGAAGCCCAGGGCCCTCCCAGG - Intronic
1096572828 12:52533607-52533629 GAGAGGTGCAGAGCCCGTCAAGG - Intergenic
1103145479 12:118591442-118591464 GAGAGGTGAAGGGGCTGCCCAGG + Intergenic
1103925655 12:124422307-124422329 GATCAGTGCAGGCCCCGCCCTGG - Intronic
1104765824 12:131329644-131329666 GAGACGGGCAGGGCAGGCCGTGG + Intergenic
1104813442 12:131632218-131632240 GAGACGGGCAGGGCAGGCCGTGG - Intergenic
1104866759 12:131960662-131960684 CAGAGGTCCAGGGCCTGCCCTGG + Exonic
1104897517 12:132171593-132171615 GAGTAGAGCAGGGCCCTCCCAGG + Intergenic
1107276786 13:38687764-38687786 GAGACGGGCTGCGCGCGCCCAGG - Exonic
1108180888 13:47838757-47838779 GAGACCTGCAGGCCAAGCCCTGG - Intergenic
1119740430 14:77010557-77010579 GAGACTTGCAGGGACCCCTCAGG - Intergenic
1122268356 14:100557114-100557136 GAGGCCGGCAGGGCCCGCGCTGG - Intronic
1122650013 14:103220956-103220978 GGGACGTCCAGTGCCCGCGCAGG + Intergenic
1123130942 14:105984800-105984822 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123538556 15:21262532-21262554 GAGGCGTGCAGGGCAGCCCCGGG + Intergenic
1123581170 15:21716021-21716043 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123617819 15:22158644-22158666 GAGATGTGCATGGCCTGCCTGGG + Intergenic
1123710031 15:22980311-22980333 GAAACTCCCAGGGCCCGCCCAGG - Exonic
1131110482 15:89761588-89761610 GAAGAGTGCAGGGCCGGCCCAGG + Intronic
1131176694 15:90213689-90213711 CAGACTTACAGGGCCTGCCCAGG + Intronic
1132648362 16:1009480-1009502 GCTGCGTGCAGGGCCTGCCCTGG - Intergenic
1132843588 16:1990126-1990148 GGGCCGCGCAGGGGCCGCCCTGG + Exonic
1135752951 16:25071432-25071454 GGGAAGTGCAGGGTCCCCCCAGG - Intergenic
1136180435 16:28548277-28548299 GAGACGACCAGGACCAGCCCTGG - Intergenic
1136381981 16:29900117-29900139 GCGTCGGGCCGGGCCCGCCCCGG - Intergenic
1137487788 16:48906191-48906213 GAGCCATGCAGGGCCGGCTCTGG + Intergenic
1137774189 16:51041810-51041832 GCCAAGTGCAGGGCCCGCCACGG + Intergenic
1139491578 16:67288785-67288807 CAGACCTGCAGGGCCAGGCCAGG - Exonic
1141667633 16:85474167-85474189 GAGAGGTGCTGGGCCAGGCCAGG + Intergenic
1141720036 16:85750964-85750986 GAGGCGCGCGAGGCCCGCCCGGG + Exonic
1142249358 16:88984002-88984024 GCGACGTGCCGGTGCCGCCCCGG + Intergenic
1142858941 17:2749504-2749526 GGGATCTGCAGCGCCCGCCCCGG + Intergenic
1144641943 17:16942327-16942349 AAGACGGGCAGTGCCAGCCCTGG - Intronic
1144999289 17:19292238-19292260 GAGGGCAGCAGGGCCCGCCCGGG + Intronic
1147393149 17:40122258-40122280 GAGACGAGGCGGGCCCGGCCGGG + Intergenic
1147553227 17:41460023-41460045 CAGAAGAGCAGGGCCAGCCCCGG - Exonic
1150124678 17:62628271-62628293 GGGACCTGCAGGGCGCGCCCGGG + Intronic
1150289420 17:63972932-63972954 GAGGAGTGGACGGCCCGCCCAGG - Intergenic
1154163364 18:11996248-11996270 GAGCTGTGAAGGGCTCGCCCTGG + Intronic
1157716136 18:49888688-49888710 GAGAGGAGCTGGGCCCACCCAGG - Intronic
1160106908 18:75986947-75986969 GAGATATGCAGGGCCCGCCCTGG - Intergenic
1160428809 18:78797259-78797281 GAGGAGAGCTGGGCCCGCCCTGG + Intergenic
1160710653 19:549558-549580 GAGGGGAGCAGGGCCCGCCGAGG - Intronic
1160791319 19:925091-925113 GAGACGTGCAGGGACCTCCCTGG + Intergenic
1162757132 19:12867166-12867188 GAGGCGTGCAGGGCCTAGCCTGG + Intronic
1165744805 19:38224271-38224293 GCGACGGGGCGGGCCCGCCCGGG + Intronic
1167153856 19:47726148-47726170 GCGACATCCAGGGCCTGCCCCGG + Exonic
1167889342 19:52527501-52527523 AAGACGCGCAAGTCCCGCCCCGG + Intergenic
1167894473 19:52570131-52570153 GAGACGCACAGGTCCCGCCCCGG + Intronic
1167903390 19:52638486-52638508 GAGACTCACAGGTCCCGCCCTGG - Intronic
1167909563 19:52690620-52690642 GAGACACACAGGTCCCGCCCCGG - Intergenic
1167915291 19:52735175-52735197 GAGACGCGCAGATCCCGCCCCGG - Intergenic
1167921591 19:52786888-52786910 GAGAAGCACAGGTCCCGCCCCGG - Intronic
1167940568 19:52942729-52942751 GAGACGCACAGGTCCCGCCCCGG - Intronic
1168115946 19:54221439-54221461 GAGACCTGCAGGGCCAGGACGGG - Intronic
1168118929 19:54241187-54241209 GAGACCTGCAGGGCCAGGACGGG - Intronic
928225047 2:29441381-29441403 TAGCAGGGCAGGGCCCGCCCTGG + Intronic
928515311 2:32039453-32039475 GTGACTTGCAGGGTCCGCCATGG - Exonic
929456189 2:42067804-42067826 GAGTGGTGCAGGGCTCGCCAAGG - Intergenic
929947266 2:46380790-46380812 GAGAGGGGCAGGGGCCTCCCTGG - Intronic
932798139 2:74715541-74715563 GAAATGTGCAGAGCCGGCCCTGG - Intergenic
937264452 2:120607181-120607203 GAGGCGTGCAGAGCTGGCCCAGG + Intergenic
938672710 2:133601034-133601056 GAAAGGTGGAGGGCCCGGCCAGG - Intergenic
940954371 2:159712211-159712233 TAGACGGGCGGGGACCGCCCCGG + Intergenic
948281026 2:236748175-236748197 GAGACGTGCAGGCCCCCACATGG + Intergenic
948322909 2:237085388-237085410 GGGGCGTGCAGGGCTAGCCCGGG + Exonic
948425258 2:237883210-237883232 GATACCTGCAGGCCCAGCCCAGG - Intronic
948772756 2:240259937-240259959 GTGGCCTGCAGGGCCAGCCCTGG + Intergenic
1169073831 20:2749808-2749830 GAGGCCTGCAGGTCCCGCACCGG - Intronic
1171266665 20:23776626-23776648 GAAAAGTGCAGGGCCCTCCTGGG + Intergenic
1175394681 20:58650374-58650396 GCGTCGGGCAGGGGCCGCCCGGG - Intergenic
1175399529 20:58692728-58692750 GAGACGTGCAGGGCCCGCCCGGG - Exonic
1176107898 20:63398156-63398178 GGGACGTGCGGGGCCCCCCAGGG - Intergenic
1178351133 21:31873638-31873660 GAGACGAGCAGGAGCCGCGCGGG + Exonic
1178707931 21:34889858-34889880 GGGAGGTGCAGGGCCCGGCAGGG - Intronic
1178924272 21:36761912-36761934 CCCAAGTGCAGGGCCCGCCCAGG - Intronic
1179664233 21:42899082-42899104 GAGGCCTGCAGGGCCCGTCAAGG - Intronic
1179726048 21:43341745-43341767 GAGACGAGCAGGGGCTGGCCTGG - Intergenic
1180102721 21:45596853-45596875 GACACCTGCAGGGCCCTCCGGGG - Intergenic
1180844226 22:18972702-18972724 GGCACGTGCAGGGCCTGCCGTGG + Intergenic
1181057246 22:20266009-20266031 GGCACGTGCAGGGCCTGCCGTGG - Intronic
1182049670 22:27303096-27303118 GAGAGGTGAAGGGACTGCCCAGG + Intergenic
1183623678 22:38989170-38989192 GAGAGGGGCAGGGTCCTCCCCGG + Intronic
1184161138 22:42697953-42697975 GAGAGGTGCAGGGCATGGCCGGG + Intronic
954151005 3:48657062-48657084 GGGCCCTGCAGCGCCCGCCCCGG + Exonic
954325033 3:49858945-49858967 GGGACCTGCAGGGCCTGCCTAGG + Exonic
954669147 3:52278791-52278813 GAGACGTGCAGGGCCTTCCCGGG + Intronic
959648271 3:108726736-108726758 GAGATGTGCTGGGCCTCCCCTGG + Intergenic
961336539 3:126183572-126183594 GAGACTTTCAGGACCCGCCCAGG + Intronic
961373544 3:126447760-126447782 GAGACGTGCAGGGTCCACAGAGG - Intronic
968551592 4:1226267-1226289 GTGCCGTGCAGGGGCGGCCCTGG - Intronic
969124657 4:4937739-4937761 GAGACGTGCTTGGCCTTCCCGGG - Intergenic
969137899 4:5045201-5045223 GAGAGGTACAGAGCCCGCTCAGG - Intergenic
970436214 4:16037936-16037958 GAGGCGTTCAAGGCCCTCCCAGG + Intronic
976389981 4:84497587-84497609 GAGTGATGCAGAGCCCGCCCTGG - Exonic
978587646 4:110291490-110291512 TAGACGTGCAGGGCCATCCCAGG - Intergenic
981615381 4:146639054-146639076 GAGAAGTGCCGGGCCAGCCGGGG - Exonic
985950486 5:3218581-3218603 GAGCCCTGCAGGGCTTGCCCTGG - Intergenic
996802578 5:127420144-127420166 CACACGTGCAGGTCCCGTCCAGG - Exonic
997472755 5:134125784-134125806 GAGTAGGGCAGGGCCTGCCCGGG + Intronic
998816271 5:146017377-146017399 CACATGTGCAGGGCCCTCCCTGG + Intronic
1002047473 5:176550015-176550037 GAGATGTGCAAGGCCCGGACTGG - Intronic
1002305174 5:178278889-178278911 GTGACGCGCTGGGCCAGCCCTGG + Intronic
1002427898 5:179186567-179186589 GAGGCCTGCAGGGCCCACCTGGG + Intronic
1002634422 5:180600075-180600097 GAGCTGTGTAGGGCCCTCCCGGG + Intergenic
1002927275 6:1611674-1611696 GCCACTTGCAGGGCGCGCCCGGG + Exonic
1006083347 6:31580132-31580154 GAGAAGTGCGGGGCCCCTCCAGG + Intergenic
1006444257 6:34069966-34069988 GACACGTGCGGGGCCTGCCCAGG + Intronic
1007376700 6:41461888-41461910 GAGGGGTGCTGGGCTCGCCCTGG - Intergenic
1013293170 6:108736142-108736164 AAGACTTCCAGGGCCCGCCCAGG - Intergenic
1014633388 6:123814831-123814853 CAGACGTGCAGGCCCTGCCCTGG + Intronic
1016827295 6:148400290-148400312 GACACCTGCAGGGCCCAGCCTGG + Intronic
1017751638 6:157494245-157494267 GTGAAGTGCTGGGCCCTCCCTGG + Intronic
1018441776 6:163820361-163820383 GAGACGTGCCGGGCACGTACCGG + Intergenic
1019522282 7:1466371-1466393 GAGCCCAGCAGGGCCCGCCATGG + Intergenic
1019666772 7:2255907-2255929 GAGAAGGGCAGGGCGCACCCTGG + Intronic
1019712870 7:2525356-2525378 GAGCCTGGCAGCGCCCGCCCCGG + Intronic
1019716686 7:2542479-2542501 GAGAGGGGCAGTGCCCGCTCAGG + Intronic
1021518563 7:21515173-21515195 GAGATTTGCAGGGCTCTCCCAGG - Intergenic
1024354787 7:48403350-48403372 GAGGGATGCAGGGCCCTCCCTGG + Intronic
1024582296 7:50809866-50809888 GACACCTGCAGGGCCAGACCAGG + Intergenic
1024705237 7:51950353-51950375 GAGGCGTGCAGGGCCCCCTGTGG - Intergenic
1024948434 7:54834403-54834425 GAGACGTCTGGGGCCCGCCCTGG - Intergenic
1026996005 7:74617214-74617236 GAGACCGGCAGGGCCCTGCCTGG + Intergenic
1029109813 7:98207247-98207269 GACCCGTGCAGGGGCCGCCTGGG + Exonic
1029110689 7:98211770-98211792 GACACGTGCAGGGACAGCACTGG - Intronic
1029123292 7:98282009-98282031 GAGGCGGGTGGGGCCCGCCCGGG + Intronic
1029373420 7:100163822-100163844 GAGACCTGCAGGGCCAGGCATGG - Intronic
1032020650 7:128405693-128405715 CGCACGTGCAGGGCCGGCCCGGG + Intronic
1033552901 7:142463641-142463663 GAGAGCTGCAGGCCCCACCCAGG + Intergenic
1033555222 7:142483079-142483101 GAGAGCTGCAGGCCCCACCCAGG + Intergenic
1033559828 7:142520615-142520637 GAGAACTGCAGGCCCCACCCAGG + Intergenic
1036577381 8:10040666-10040688 GAGATGTGCATGGCAAGCCCAGG - Intergenic
1039430454 8:37521445-37521467 GGGCCCTGCAGGGCCCCCCCAGG - Intergenic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1049236431 8:141514630-141514652 GAGACGGGGAGGGGCCTCCCAGG - Exonic
1049269452 8:141686521-141686543 CAGACGTGGAGGGCCGGCCCAGG - Intergenic
1049327391 8:142030001-142030023 GAGACGTGCAGGGCTTTCTCGGG - Intergenic
1049409293 8:142465247-142465269 CAGGTGTGCAGGGCCAGCCCGGG + Intronic
1057266292 9:93620130-93620152 CAGACCTGCAGGGCCCAGCCTGG + Intronic
1061261488 9:129482970-129482992 GAGGCGTGCAGGGCGCGGCGCGG - Intergenic
1061899347 9:133665141-133665163 GAGACGTGCACCGGCCGCTCTGG + Intronic
1062134661 9:134918797-134918819 GAGAAGTGGAGGGGCGGCCCAGG + Intergenic
1062391858 9:136337075-136337097 GAGTGGGGCAGGGCCAGCCCAGG + Intronic
1185447750 X:268340-268362 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185447864 X:268725-268747 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185447959 X:269055-269077 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185447992 X:269165-269187 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185448024 X:269275-269297 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185448040 X:269330-269352 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185448057 X:269385-269407 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185448156 X:269715-269737 GGGCCCTGCAGGCCCCGCCCAGG - Intergenic
1185448222 X:269935-269957 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1185448255 X:270045-270067 GGGTCCTGCAGGCCCCGCCCAGG - Intergenic
1187900790 X:24025426-24025448 GAGCCGCCCGGGGCCCGCCCAGG + Intronic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic