ID: 1175400380

View in Genome Browser
Species Human (GRCh38)
Location 20:58696824-58696846
Sequence GACAACAGGATGTATCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175400380_1175400386 2 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400386 20:58696849-58696871 CACGACATTGAGTGGCTCACCGG 0: 1
1: 0
2: 0
3: 3
4: 74
1175400380_1175400392 20 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400392 20:58696867-58696889 ACCGGGGCCACGGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 8
4: 121
1175400380_1175400388 4 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400388 20:58696851-58696873 CGACATTGAGTGGCTCACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1175400380_1175400387 3 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400387 20:58696850-58696872 ACGACATTGAGTGGCTCACCGGG 0: 1
1: 0
2: 0
3: 7
4: 44
1175400380_1175400395 30 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400395 20:58696877-58696899 CGGCAGCAAGGGGCAGAGCCAGG 0: 1
1: 1
2: 12
3: 72
4: 678
1175400380_1175400391 19 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400391 20:58696866-58696888 CACCGGGGCCACGGCAGCAAGGG 0: 1
1: 0
2: 1
3: 9
4: 120
1175400380_1175400390 18 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400390 20:58696865-58696887 TCACCGGGGCCACGGCAGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1175400380_1175400382 -6 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400382 20:58696841-58696863 GTTGTCCCCACGACATTGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 46
1175400380_1175400389 10 Left 1175400380 20:58696824-58696846 CCTGTGAGATACATCCTGTTGTC 0: 1
1: 0
2: 1
3: 8
4: 153
Right 1175400389 20:58696857-58696879 TGAGTGGCTCACCGGGGCCACGG 0: 1
1: 0
2: 1
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175400380 Original CRISPR GACAACAGGATGTATCTCAC AGG (reversed) Intronic
901869364 1:12128498-12128520 GATAACAGTAAGTACCTCACAGG - Intronic
902223549 1:14982096-14982118 GATAACAGGACCCATCTCACCGG - Intronic
903407316 1:23108706-23108728 GACAACAGTACTTACCTCACAGG + Intronic
905079177 1:35302120-35302142 GTCAACAAGCTGTAGCTCACAGG + Intronic
905259475 1:36707293-36707315 GACAACAGCAGGTCTCTCCCAGG + Intergenic
905512678 1:38535182-38535204 GATAATAGGATTTATCTCATAGG - Intergenic
906523421 1:46480146-46480168 GAGAAAAGGATTTATCTCAGGGG - Intergenic
908076782 1:60528503-60528525 TACAACATGATGGATCTCATAGG + Intergenic
908413531 1:63890059-63890081 GACAGGAAGATGTATCTCAGTGG - Intronic
910575352 1:88756882-88756904 GAAAACATCATGTACCTCACAGG - Intronic
911428513 1:97753189-97753211 AACAACAGTATCTATCTCATTGG - Intronic
915368108 1:155326602-155326624 GCCAACAGGATTTTTCTCCCTGG + Exonic
917539680 1:175900573-175900595 GATAACAGCATGTACTTCACAGG + Intergenic
917640851 1:176981994-176982016 GTCAACAGGAGGTAACTAACTGG + Intronic
917743162 1:177981424-177981446 GAAAGAAGGATGTTTCTCACTGG + Intronic
921158543 1:212456557-212456579 GACAGCAGTATCAATCTCACAGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1070520162 10:77245674-77245696 GATAAAAGAATGTATCTCATGGG + Intronic
1076560538 10:131360442-131360464 GACCACTGGCTGGATCTCACTGG - Intergenic
1077742486 11:4862029-4862051 TACATCAGGAAGTATCTCACTGG - Intronic
1078440357 11:11359926-11359948 GATAACAGCATGGACCTCACAGG + Intronic
1085662522 11:78382293-78382315 GCCTACAGGATGCCTCTCACTGG - Intronic
1086594682 11:88556620-88556642 TAATACAGGATGTATCCCACAGG - Intronic
1086965327 11:93021293-93021315 GACAACAGAATGATTTTCACAGG - Intergenic
1088709753 11:112497487-112497509 AATAATAGGATCTATCTCACAGG + Intergenic
1090319320 11:125828681-125828703 GACAATTGTACGTATCTCACAGG + Intergenic
1090945676 11:131427484-131427506 CACATCAGGATTTACCTCACAGG + Intronic
1093353616 12:18135090-18135112 GACAACAGGTTGGAATTCACAGG + Intronic
1095040649 12:37436570-37436592 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1095187634 12:39219833-39219855 GGAAACAGGATTTATGTCACTGG + Intergenic
1096931776 12:55218023-55218045 GACAACTGCTTTTATCTCACAGG - Intergenic
1099198568 12:79648765-79648787 GGCAACAGGATGGCTCTAACAGG + Intronic
1101329809 12:103748535-103748557 GACAACAATGTCTATCTCACAGG + Intronic
1102185651 12:110946333-110946355 GAAAACAGGAGGTAAATCACTGG + Intergenic
1102436944 12:112931442-112931464 GACAATAGCATCTATCTCATAGG + Intronic
1102706982 12:114890155-114890177 GTCAACATGCTGTATCTCTCAGG - Intergenic
1103645096 12:122385552-122385574 GACCACAGGATGGAACTCAGAGG + Intronic
1104436968 12:128764413-128764435 AATAACAGGCTGTATCTCATGGG + Intergenic
1105905413 13:24804964-24804986 GACAACAGTGTCTTTCTCACAGG - Intronic
1110033448 13:70648477-70648499 GAAAACAAGATGTGTATCACTGG + Intergenic
1111866444 13:93774714-93774736 CAGAACAGGATATGTCTCACTGG - Intronic
1112695831 13:101946679-101946701 GAAAACAGATTGTCTCTCACAGG + Intronic
1120166342 14:81205460-81205482 GGTAACAAGATCTATCTCACTGG + Intronic
1122191729 14:100050276-100050298 GTCAACAGGAGGTATCTCAATGG + Intronic
1132414688 15:101611981-101612003 GCCAACAGGATGAATGTCTCAGG + Intergenic
1133655984 16:7864487-7864509 GACGACAGTATGTATGTCACGGG - Intergenic
1135895857 16:26401725-26401747 AACAACCGAATGTGTCTCACAGG + Intergenic
1135930005 16:26728220-26728242 GAGACCAGGCTGTCTCTCACTGG - Intergenic
1136988607 16:35137930-35137952 GTCTAGAGGATGTACCTCACAGG - Intergenic
1137521622 16:49199967-49199989 AACAACAGTATGTATCTTATAGG + Intergenic
1138771201 16:59665787-59665809 GCCTACAGCATGTATCTCTCTGG - Intergenic
1139430573 16:66908996-66909018 GATACCAGGATCTACCTCACAGG + Intronic
1139747287 16:69084872-69084894 AACAACAGGATATTTCTCTCTGG + Exonic
1143006532 17:3839291-3839313 GACAACAGGATGTTACTGAGTGG + Intronic
1145387852 17:22430198-22430220 GACAAACAGATGTATATCACAGG - Intergenic
1146724888 17:35148673-35148695 GACAACAACAGCTATCTCACGGG - Intronic
1149327711 17:55549280-55549302 GACAACTGGGAGTATGTCACTGG - Intergenic
1149358195 17:55866089-55866111 GGCACCAGGATCTATGTCACAGG + Intergenic
1150176784 17:63066065-63066087 GACAACAGGACGTACCTTGCAGG - Intronic
1150980410 17:70135429-70135451 CACAACAAAATGTATTTCACGGG - Exonic
1155112684 18:22731916-22731938 GACAACAATATGTGTCTCAGAGG - Intergenic
1156645735 18:39160234-39160256 CCCAACAGAATGTATCACACAGG + Intergenic
1157083001 18:44548716-44548738 GACAACAGGAAGCATCTTTCAGG + Intergenic
1157342438 18:46791387-46791409 GACAAGAGCATCTACCTCACAGG + Intergenic
1161113223 19:2481392-2481414 GACAACAGCATCTTCCTCACGGG - Intergenic
1161362041 19:3855893-3855915 GACACCATGATGGATGTCACAGG + Intronic
1163298299 19:16426739-16426761 GACAACAGGATGTAACACACAGG + Intronic
1164433356 19:28207543-28207565 GGTAACAGGATGGATCCCACAGG + Intergenic
1165483730 19:36082580-36082602 AAAAACAGCATGTATGTCACAGG - Intronic
1165598938 19:37036484-37036506 GCCAGCAGGAAGGATCTCACAGG + Intronic
926417020 2:12659620-12659642 GACAATCTGCTGTATCTCACGGG - Intergenic
926498223 2:13618065-13618087 AACAAAATGATGTTTCTCACTGG + Intergenic
927923381 2:26991322-26991344 GACCACAGGCTGTACCTCAGTGG - Intronic
935020387 2:99224622-99224644 TGCAACAGCATGCATCTCACAGG + Intronic
937087451 2:119180923-119180945 GGCAACAGCAGGTATCTAACTGG - Intergenic
937971503 2:127552610-127552632 GACACCAGGATCTGCCTCACAGG - Intronic
938371265 2:130769803-130769825 GTTAACAGTATGTATGTCACGGG - Intergenic
940600525 2:155853472-155853494 GAAAATAGGATCTATATCACTGG + Intergenic
941660679 2:168192661-168192683 GACAATAGCATCTACCTCACAGG + Intronic
942738517 2:179145408-179145430 GACAATAGTATCTATTTCACAGG + Intronic
945501332 2:210579155-210579177 GAAAACAGGTTCTATCCCACGGG - Intronic
1168873423 20:1151438-1151460 GACAATAGTATCTATTTCACAGG - Intronic
1171234730 20:23514989-23515011 GACAACAGAAGGTGTCACACAGG + Intergenic
1172673333 20:36649426-36649448 GGGAATAGCATGTATCTCACTGG + Intergenic
1173378453 20:42512429-42512451 CACAACTGGATGAATCTCAAAGG - Intronic
1175400380 20:58696824-58696846 GACAACAGGATGTATCTCACAGG - Intronic
1177831996 21:26149315-26149337 GATAACAGTAGGTACCTCACAGG + Intronic
1179189277 21:39108997-39109019 GACCACAGGATGAATGACACAGG + Intergenic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1180303271 22:11054148-11054170 GACCACAGGATGTAACCCTCTGG - Intergenic
1180574597 22:16760773-16760795 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1180930023 22:19583535-19583557 AACAAGTGGATGAATCTCACAGG + Intergenic
1181892086 22:26072218-26072240 GAGAACAGGATGTCTCTCAATGG - Intergenic
1182335234 22:29579756-29579778 GTAATCAGGATGTATCTCATAGG - Intronic
1183102560 22:35592891-35592913 GAGAACAGGTTGTAATTCACTGG - Intergenic
954272798 3:49522814-49522836 GATCACAGGCTGTAGCTCACAGG - Intronic
954768669 3:52945286-52945308 GACAACTAGAAGGATCTCACTGG + Intronic
954811934 3:53254019-53254041 TACAACACAATCTATCTCACAGG + Intronic
955785459 3:62533238-62533260 GATAACAGAATGTACCTCATAGG - Intronic
957267024 3:77981306-77981328 GACAACAGGATATACATAACAGG + Intergenic
959367501 3:105480929-105480951 GACAACAGGATTTCACTCTCTGG - Intronic
960416654 3:117393194-117393216 GACAAAGGGCTGTATTTCACAGG + Intergenic
960978955 3:123203461-123203483 GACAATAGTATCTATCTCATAGG - Intronic
962054573 3:131856795-131856817 GACAACAGCAATTACCTCACGGG - Intronic
964009401 3:151872004-151872026 GACAAATGGATGTATTTCACAGG - Intergenic
969389334 4:6879247-6879269 GACAACAGTACCTACCTCACAGG - Intronic
972249232 4:37281597-37281619 GCTAACAGGACGAATCTCACAGG - Intronic
972637977 4:40901188-40901210 GATAACAGGATGGACCTCATAGG + Intronic
980832571 4:138149764-138149786 GCCAACAGGATATATCTAGCAGG + Intergenic
981684949 4:147443501-147443523 GATAACATGACCTATCTCACAGG - Intergenic
984898475 4:184563380-184563402 GCCAGCAGGAAGGATCTCACAGG + Intergenic
989200866 5:38762039-38762061 GAGAATAGGACCTATCTCACAGG - Intergenic
989232415 5:39101523-39101545 GCCAATATGATGTTTCTCACAGG + Intergenic
989843034 5:46105343-46105365 AACTACAGGACGTATCTCAAGGG - Intergenic
995678621 5:114692022-114692044 GACAACAGGAGGAATATGACTGG + Intergenic
995719533 5:115116130-115116152 GACAGCAGGATTTATCTTCCTGG - Intergenic
995941759 5:117594244-117594266 AAGAACAGGAAATATCTCACAGG + Intergenic
998528620 5:142864776-142864798 GAGGACAGTATGTACCTCACAGG - Intronic
999611639 5:153376247-153376269 GCCAACAGGATGCCTCACACTGG - Intergenic
1000107328 5:158072714-158072736 GAAAACAGTATTTTTCTCACAGG - Intergenic
1000133409 5:158321348-158321370 GACAACTGGATGTTCCTCTCTGG + Intergenic
1000164815 5:158638174-158638196 TACAAGACGTTGTATCTCACTGG - Intergenic
1000307787 5:160011442-160011464 AATAACAGTATGTATCTCATAGG - Intronic
1004376020 6:15091476-15091498 GACAACAATATGGATCTCACAGG - Intergenic
1006209144 6:32377927-32377949 GACAAAAGGATATATATCAGAGG + Intergenic
1009271785 6:61623476-61623498 GACAACAGTATGTCTCTATCAGG - Intergenic
1009366823 6:62862879-62862901 GACATCAGGAAGCATATCACAGG + Intergenic
1009933965 6:70210648-70210670 GACAAATGGAGGTATATCACAGG - Intergenic
1014100931 6:117510947-117510969 GGTAACAGGACCTATCTCACAGG - Intronic
1016391986 6:143584142-143584164 GTAAAAAGAATGTATCTCACAGG - Intronic
1020778644 7:12490458-12490480 GAAAACAGGATATATTTCAGGGG + Intergenic
1025286700 7:57668204-57668226 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1025299366 7:57805818-57805840 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1030091691 7:105863740-105863762 GATAACAGGATTTGCCTCACAGG + Intronic
1030774899 7:113522526-113522548 GACAACAGGAAGTATTTTATAGG + Intergenic
1036092556 8:5683260-5683282 AACAACTGGACGTGTCTCACGGG - Intergenic
1037176409 8:15951623-15951645 GACAACAGGATTTTTCTGATAGG - Intergenic
1039243553 8:35583049-35583071 GACAACAGGATGAACAGCACAGG + Intronic
1042184522 8:66123471-66123493 GAAAACAGCATGAATCCCACAGG - Intergenic
1046343224 8:112886660-112886682 GACAACTATATTTATCTCACAGG - Intronic
1046836801 8:118810894-118810916 GCAAGCAAGATGTATCTCACTGG + Intergenic
1048301349 8:133253451-133253473 GAGAACAGAATTTATCACACAGG + Intronic
1051822051 9:21180414-21180436 GGCAACAGGTTGTACCTCTCTGG + Intergenic
1051823278 9:21192476-21192498 GGCAACAGGTTGTACCTCTCTGG + Intergenic
1051825096 9:21211012-21211034 GGCAACAGGTTGTACCTCTCTGG + Intronic
1051827085 9:21233075-21233097 GGCAACAGGTTGTACCTCTCTGG + Intronic
1052132835 9:24870613-24870635 GACAAAAGGATGAAGATCACCGG - Intergenic
1052548658 9:29917248-29917270 GACAAAATAATGCATCTCACTGG + Intergenic
1052873188 9:33528397-33528419 GACAACAGCAGCTAGCTCACAGG - Intronic
1053121197 9:35548401-35548423 GCCAGCAGGAGGCATCTCACTGG - Exonic
1053363179 9:37503993-37504015 TACAACAGGCTGTATCCTACTGG - Intergenic
1053794212 9:41710209-41710231 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1054182618 9:61922248-61922270 GCCAGCAGGAAGGATCTCACAGG - Intergenic
1054470739 9:65535730-65535752 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1054655889 9:67666231-67666253 GCCAGCAGGAAGGATCTCACAGG + Intergenic
1057705656 9:97393204-97393226 GGTAAGAGGATGAATCTCACAGG - Intergenic
1059892449 9:118817948-118817970 GACAACAGAAAGTATCTCTGAGG - Intergenic
1060210938 9:121710000-121710022 TGCAACAGTATATATCTCACGGG - Intronic
1060256525 9:122035630-122035652 GAGAACAGGATGGATCTGAAAGG - Intronic
1186637075 X:11417881-11417903 GATAATAGGACCTATCTCACAGG + Intronic
1189955147 X:46270321-46270343 GATAACATGATACATCTCACAGG - Intergenic
1190300891 X:49056919-49056941 GATAACAGTATGTACCTCACGGG - Intronic
1192185610 X:68944875-68944897 GATAACAGCATGTAGCTCACAGG + Intergenic