ID: 1175402209

View in Genome Browser
Species Human (GRCh38)
Location 20:58707219-58707241
Sequence ACCCAGGATGCCCCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175402209_1175402218 22 Left 1175402209 20:58707219-58707241 CCCTCTGCAGGGGCATCCTGGGT 0: 1
1: 0
2: 5
3: 34
4: 289
Right 1175402218 20:58707264-58707286 TCCCCTGTCCGTCCCGCCACAGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175402209 Original CRISPR ACCCAGGATGCCCCTGCAGA GGG (reversed) Intronic
900786023 1:4651157-4651179 AGCCAGCAGGCCCCTGCAGGAGG - Intergenic
900908973 1:5580617-5580639 ACCCCAGATCCCCCTTCAGAGGG + Intergenic
901301051 1:8200393-8200415 ACCCAGGATGGCCTTCCACATGG + Intergenic
901453292 1:9349163-9349185 ACCTTGGCTTCCCCTGCAGAGGG - Intronic
902371871 1:16012670-16012692 ATCCAGGTTGACCCAGCAGATGG + Intergenic
902455755 1:16532982-16533004 GCCCAGGATGCCCGTGCAGAGGG + Intergenic
902496417 1:16874930-16874952 GCCCAGGATGCCCGTGCAGAGGG - Intronic
903069428 1:20719490-20719512 GCCCAGGTTGCCAGTGCAGAAGG + Intergenic
903154007 1:21431551-21431573 ACCCAGGAAGCCCATGGTGAAGG - Intergenic
904289265 1:29473666-29473688 CCCCAGGAAGGGCCTGCAGATGG - Intergenic
904392412 1:30194791-30194813 AGCCAGGAGGCCCATGCAGCAGG + Intergenic
905344384 1:37301546-37301568 ACCCAGGATGCTAGTGCAGCAGG - Intergenic
906166747 1:43692105-43692127 ACCCAGGCAGCCCCTGCACCAGG - Intronic
906776142 1:48531418-48531440 ACCCAGCATCCCCCTAGAGAGGG + Intergenic
907093694 1:51754125-51754147 AGCTAGGAGGCCCCTGCAGGTGG + Intronic
909151184 1:72007483-72007505 AGCCAGGGTGCCCCTGAAGAAGG + Intronic
909761217 1:79289659-79289681 TCCCAGGATGACCCTGCACTAGG - Intergenic
911497710 1:98651081-98651103 ACCCAGGATGTTCGTGCTGAGGG + Intergenic
913661125 1:121007279-121007301 GCCCAGGATGCCGGTGCAGAGGG + Intergenic
914012493 1:143790459-143790481 GCCCAGGATGCCGGTGCAGAGGG + Intergenic
914165339 1:145170724-145170746 GCCCAGGATGCCGGTGCAGAGGG - Intergenic
914651122 1:149699069-149699091 GCCCAGGATGCCGGTGCAGAGGG + Intergenic
915529510 1:156495178-156495200 AACCAGGATTCCTCAGCAGAGGG - Intronic
915599071 1:156910947-156910969 TCCCAGGCTTCCCATGCAGAAGG - Intronic
916641267 1:166730547-166730569 TTCCAGGCTGGCCCTGCAGAGGG - Intergenic
921343086 1:214153929-214153951 ACCCATGGCTCCCCTGCAGATGG + Intergenic
921400181 1:214713521-214713543 ACCCAGGAGGCCAAGGCAGAGGG - Intergenic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
923192679 1:231635040-231635062 ACCTAGGATGCCTCTTCAGAAGG + Intronic
1063702620 10:8400280-8400302 AGCCAGGATGGCTCTGCAGCTGG - Intergenic
1065245467 10:23751765-23751787 TCACAAGAAGCCCCTGCAGATGG - Intronic
1065309454 10:24400424-24400446 ACCCAGGGTCCCCATGCTGATGG + Intronic
1065504066 10:26411545-26411567 CACCAGGATGTCACTGCAGAAGG + Intergenic
1069472528 10:68705698-68705720 ACCCAGGAGGCTGATGCAGAAGG + Intergenic
1069823702 10:71242637-71242659 ACCCTGGCTGTCCCTGCAGAGGG + Intronic
1070371373 10:75785463-75785485 AGCCATCATGCCCCTGCAGGAGG - Intronic
1070719302 10:78745262-78745284 CCCCTGGCTGCCCCTGCAGAAGG + Intergenic
1070767642 10:79065990-79066012 ACCCAGGAAGTGGCTGCAGAGGG - Intergenic
1071239682 10:83691864-83691886 ACCCAAGCTGTCACTGCAGAAGG - Intergenic
1071496233 10:86169462-86169484 TTCCAGCATGCCCCTGCACAGGG + Intronic
1072625250 10:97107194-97107216 CTCCAGGAGGCCCCTGCAGCTGG - Intronic
1072715981 10:97752963-97752985 GCGCAGGATGCCTCTGCACACGG + Intronic
1076667672 10:132102376-132102398 CCTCAGGATGCCACTGCAGACGG - Intergenic
1076890258 10:133279937-133279959 GCCCAGCATGCACCCGCAGAAGG - Intronic
1077230376 11:1455902-1455924 TCCCAGGAAGCCCCAGCAGGAGG + Intronic
1077326146 11:1964930-1964952 ACCCACGCTGTCCCTGCCGACGG - Intronic
1077878261 11:6325756-6325778 ACCCAGGATGCTCCTGCAAATGG + Intergenic
1077883846 11:6371408-6371430 AGCCAGGATGACCCAGGAGAAGG - Intergenic
1079079392 11:17403365-17403387 ACCCAGTCTGACCCTGGAGATGG - Intronic
1079128605 11:17735222-17735244 ACCCCGGGTGCCCCTGCCCAGGG + Exonic
1079136799 11:17779960-17779982 CCCCAGGCTGCTCTTGCAGATGG + Intronic
1079392167 11:20032129-20032151 ACCAAAGCTGCCCCTGCAGCTGG - Intronic
1079503998 11:21133469-21133491 ACCCAGGCTGTTCCTGCTGAGGG + Intronic
1079608442 11:22399720-22399742 ATCCATTATGACCCTGCAGAGGG + Intergenic
1081284041 11:41246153-41246175 GCCCAGGTTGTTCCTGCAGAGGG + Intronic
1081517461 11:43847121-43847143 AAACAGGATGGCACTGCAGACGG - Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082757431 11:57091982-57092004 AGCCTGGATGCTCCTGTAGAAGG + Intergenic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1083277876 11:61607459-61607481 ACCCAGTTTCCCTCTGCAGAGGG + Intergenic
1083618429 11:64037277-64037299 ACCCACGATGCCACTGTGGAGGG + Intronic
1084673051 11:70618931-70618953 ACACAGGCTGACCCGGCAGATGG + Intronic
1084901286 11:72311776-72311798 AGCCAGGCTGCCTGTGCAGAGGG - Intronic
1086923016 11:92608862-92608884 TCCCAGCAGGCCCCTGCAAAGGG - Intronic
1090411349 11:126511977-126511999 ACCCAGGATGCCCAGGAAGCTGG + Intronic
1090808141 11:130215657-130215679 AGCCAGGAGGTGCCTGCAGAGGG + Intergenic
1090984842 11:131757044-131757066 AGACAGGCTGCCCCTGCTGAAGG - Intronic
1091139691 11:133224315-133224337 CCCAGGGATGCCCCTGCAGATGG + Intronic
1202809126 11_KI270721v1_random:20109-20131 ACCCACGCTGTCCCTGCCGACGG - Intergenic
1091625944 12:2121129-2121151 CTCCAGGATGCCTCTGCAAAAGG + Intronic
1091671574 12:2455918-2455940 ACCTAGGAGGCCAGTGCAGAAGG - Intronic
1091742604 12:2970751-2970773 GCTCAGGATGCACCTGCCGAGGG - Intronic
1091758202 12:3069661-3069683 AAGCAGAATGCCCCTGCAAAAGG - Intergenic
1093911041 12:24747722-24747744 ACCCTGAATCCCCCGGCAGAAGG + Intergenic
1094088955 12:26626671-26626693 AGGCAGCATGCCGCTGCAGAAGG - Intronic
1095596130 12:43960273-43960295 ACCCAGGGAGGCCCTGGAGAGGG + Intronic
1096514055 12:52146718-52146740 ACCCTGGATTCCCCGGCAGGGGG - Intergenic
1100270516 12:93020224-93020246 ACCCAGGCTACCTCTGCACAGGG + Intergenic
1101372304 12:104140497-104140519 ACCTAGGATCCAACTGCAGAGGG - Intergenic
1101678606 12:106942826-106942848 ACCCAGAGTGCCCATGTAGAAGG + Intergenic
1103173640 12:118843601-118843623 ACCCAGGCTGTCCGTGCTGAGGG - Intergenic
1103243336 12:119433518-119433540 AATCAGGATTCCCCTTCAGAAGG + Intronic
1103459185 12:121090141-121090163 CCCCAGGCTGGGCCTGCAGAGGG - Intergenic
1104689894 12:130818001-130818023 CCCCAGGAAGGCCCTGCAGTGGG + Intronic
1104744487 12:131202454-131202476 ACCCAGGAGGACCCAGCAGCAGG + Intergenic
1104754742 12:131261993-131262015 TCTCACGATGCCACTGCAGAGGG + Intergenic
1104789892 12:131474769-131474791 ACCCAGGAGGACCCAGCAGCAGG - Intergenic
1104801181 12:131556135-131556157 AGCCACGATGCCCATGGAGAGGG - Intergenic
1106655722 13:31744019-31744041 ATCCAGGAAGCCCCTGGGGAGGG - Intronic
1107598724 13:41990880-41990902 CCCCAGGATGCTCTTGGAGAAGG - Intergenic
1110672307 13:78195112-78195134 ACAAAGGATGCCCCAGCAGGGGG - Intergenic
1114760459 14:25308447-25308469 AACCTGTATGCCCCAGCAGAGGG + Intergenic
1116756704 14:48957676-48957698 ACTCAGGCCGCCCCTCCAGAGGG + Intergenic
1121008108 14:90503313-90503335 TCCCAGGTGGCCCCTGCAGCCGG + Intergenic
1121675327 14:95747713-95747735 AACCAGGATGCCCTTTAAGAAGG + Intergenic
1122037951 14:98962051-98962073 GCCCAGGATGTCCCAGCAGTGGG + Intergenic
1122100894 14:99408902-99408924 TCCCAGGGTGGGCCTGCAGAGGG + Intronic
1122491210 14:102117182-102117204 ACCCAGGCTGTTCCTGCTGAGGG - Intronic
1122651047 14:103227288-103227310 ACTCAGGCTGGCCCTGCAGGAGG - Intergenic
1122723801 14:103737235-103737257 ATCCTGGCTGCCCCTGAAGAAGG + Intronic
1202862172 14_GL000225v1_random:89836-89858 AGCCAGGCTGCACCGGCAGAGGG - Intergenic
1123451047 15:20358794-20358816 CCCCAGGAAGCCCCTCCAGGGGG - Intergenic
1123720950 15:23061573-23061595 ATCCAGGGTGCCCAGGCAGAAGG - Intergenic
1124364819 15:29063982-29064004 ATTCAGGAGGGCCCTGCAGAGGG - Intronic
1124422853 15:29537770-29537792 ACTCAGGAGGCCCCTACTGATGG + Intronic
1124989769 15:34660139-34660161 ACCCAGGAATCCCCTGAAGAGGG + Intergenic
1128367341 15:67013722-67013744 ACCCAAGATTCCCCTGTGGATGG - Intergenic
1131447344 15:92511516-92511538 AGCCAGGATGAGCCTGGAGAAGG - Intergenic
1132648047 16:1008043-1008065 ACCCAGGAAGCCCCTTCAAGGGG + Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1133756731 16:8767527-8767549 ACCCAGGAGTCCCCAGCAGCTGG + Intronic
1135196496 16:20399270-20399292 ACTCTGGATGCCCCTGCTGCTGG - Exonic
1137559621 16:49494336-49494358 GCCCAGGATGTCACAGCAGATGG + Intronic
1137848510 16:51715153-51715175 AGCCAGGATGCTTCTGCAAAGGG - Intergenic
1138537596 16:57668119-57668141 ACCCTGGGTCCACCTGCAGAGGG - Intergenic
1139150939 16:64381284-64381306 ACCCAGGATGTTCATGCTGAGGG - Intergenic
1139550050 16:67667932-67667954 ACCCAAGCTGCCGCTGCAGGAGG + Exonic
1139601647 16:67990994-67991016 TCCCAACATGTCCCTGCAGAAGG - Exonic
1140890345 16:79279536-79279558 GCCCAGGATCCACCTGCAGTGGG - Intergenic
1141509792 16:84504878-84504900 ACCAAGGAGGCGCCTGGAGAGGG + Intronic
1141608911 16:85170374-85170396 GTCCAAGAGGCCCCTGCAGACGG + Intergenic
1142202327 16:88767257-88767279 GCCAGGGATGCCCTTGCAGATGG - Intronic
1142286317 16:89172957-89172979 ACTCAGGAAGCCCCTTCAGTGGG - Intronic
1142752321 17:1996400-1996422 GCCCAAGGTCCCCCTGCAGAGGG + Intronic
1143446381 17:7012603-7012625 GCCCAGGATGCCCTCGCAGGGGG - Exonic
1143914057 17:10275862-10275884 ACCCAGGTAGCCTCTGGAGAGGG + Intergenic
1144662963 17:17083225-17083247 TCCCAGGTTGCCCCTGAAAAAGG - Intronic
1144862563 17:18314807-18314829 CCCCAGGATGCGCCGGCAGCCGG - Exonic
1150917530 17:69451764-69451786 ATACAGGCTGCCCCTGCAGAGGG + Intronic
1151334552 17:73432204-73432226 TCCCTGGGTCCCCCTGCAGAAGG - Intronic
1151734603 17:75931277-75931299 ACCCAGGAGGGACCTGCAAAGGG + Exonic
1152461879 17:80445911-80445933 TGGCAGGAGGCCCCTGCAGATGG - Intergenic
1153694917 18:7630283-7630305 ACCAGGGAAGCCCCTGAAGAGGG + Intronic
1153820437 18:8827144-8827166 AGCCAGGCTGCTCCCGCAGATGG + Intronic
1153984194 18:10338409-10338431 AGCCAGGATGCCTGTGCAAAGGG + Intergenic
1155036118 18:22026417-22026439 AACCAGGCTGGCCCTGCAGATGG + Intergenic
1155914582 18:31543335-31543357 ACCAAGCCTGCTCCTGCAGAGGG - Intronic
1156278625 18:35610242-35610264 ACACAGGAAGATCCTGCAGAAGG - Intronic
1156450963 18:37266334-37266356 ACCGAGAGTGCCCCTGCAGTGGG - Intronic
1157045560 18:44098939-44098961 TTCCAGGCTGACCCTGCAGAGGG + Intergenic
1157117377 18:44874785-44874807 ACCCAGGATTGTTCTGCAGATGG - Intronic
1158482119 18:57831214-57831236 ACCCACAATTCCCCTGCATATGG + Intergenic
1158570677 18:58594826-58594848 ACCCAGGACGGTCCTGCAGAAGG - Intronic
1158588431 18:58760266-58760288 CCCCAGGGTGTCCCAGCAGAAGG - Intergenic
1160011822 18:75111860-75111882 CCCCGGGAAGCACCTGCAGACGG + Intergenic
1160169145 18:76538529-76538551 ACCCAGCATGGCCCTGAGGAAGG - Intergenic
1160450755 18:78964938-78964960 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450773 18:78965000-78965022 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160450792 18:78965061-78965083 ACCCAGGCTGCCCCTCCACCCGG + Intergenic
1160800028 19:963489-963511 TCCCAGGCTGCCCCTGCACCAGG - Intronic
1160820121 19:1053987-1054009 ACCCCTGATGGCCCTGCAGATGG + Exonic
1161018124 19:1993465-1993487 GCCCGGGATGCCCCAGGAGAGGG + Intronic
1163288847 19:16365575-16365597 CCCCAGGGTGCCCCTGCCGGTGG - Intronic
1164831592 19:31325777-31325799 AACCAGAATGTCCATGCAGAGGG + Intronic
1166039715 19:40194470-40194492 ACCCAGCATGCTCCTGTTGAAGG + Intronic
1166147812 19:40849534-40849556 ACCCAGGATGTCCTTAGAGATGG + Intronic
1166257200 19:41615065-41615087 ACCCAGGATGCAGCTGAGGACGG + Intronic
1167100023 19:47399028-47399050 ACCCAGGATGCCCCTGAACCAGG + Intergenic
1202706647 1_KI270713v1_random:29339-29361 GCCCAGGATGCCCGTGCAGAGGG + Intergenic
925874146 2:8297708-8297730 AGCAAGGATGCCTCTGCAGGAGG - Intergenic
925901775 2:8514045-8514067 ACCTAGGTTGCTCCTGCAGGAGG + Intergenic
926307354 2:11648032-11648054 TCCCAGGCTGCAGCTGCAGAGGG - Intergenic
926473651 2:13293873-13293895 AGCCATGAGGCCACTGCAGAGGG + Intergenic
926748596 2:16180561-16180583 ACCCAGCAAGGCCCTGCTGATGG - Intergenic
929781750 2:44961589-44961611 ACCCAGGATGCCCATGAAGAAGG + Intergenic
929795993 2:45058722-45058744 ACCCAGGATGCCCACCCAGGTGG + Intergenic
932560481 2:72863203-72863225 ACCCAGGCTGCCGCAGCCGAAGG + Intergenic
933773691 2:85759144-85759166 ACTCAGGGTGGCCCTGGAGAGGG + Intronic
933807636 2:86011835-86011857 TCCCAGGAGACCCATGCAGAGGG - Intergenic
933813436 2:86047761-86047783 ACCAAGCATGCCCCTTCAGGGGG + Intronic
934244396 2:90294983-90295005 ACCCAGGAGGCCCAGGCAGGAGG + Intergenic
936647928 2:114393205-114393227 ACCCTGGAAGCCCCTGCCGCAGG - Intergenic
936790160 2:116141902-116141924 AGCCAGGATGAGCCAGCAGAAGG + Intergenic
937905067 2:127049148-127049170 GCCGAGGCTGCCCCTGCAGCTGG + Intronic
938062814 2:128266124-128266146 ACCCAGGAAGCCCATGGTGAAGG + Exonic
938152896 2:128902033-128902055 AGCCAGGAGGCACCTGCAGGAGG - Intergenic
938163773 2:129009090-129009112 ACCCAGTGTCCCCCAGCAGAGGG - Intergenic
938915400 2:135933945-135933967 ACCCCGTCTGCCCCTGCAGCTGG - Exonic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
941863872 2:170313466-170313488 ACCAAGGCTGGCCCTGAAGATGG - Intronic
942470085 2:176251003-176251025 ACCCAGGGGAACCCTGCAGAGGG - Intergenic
946137400 2:217658576-217658598 TCCAAAGATGACCCTGCAGATGG + Intronic
946394979 2:219439085-219439107 ACTCAGGATTCCCCTGGAGAGGG - Intronic
947938161 2:234025219-234025241 ACACAGGAGACCCCTGCATAGGG + Intergenic
948147120 2:235716240-235716262 TCCCAGTATGTCCCTGCAGATGG + Intronic
948503542 2:238411779-238411801 ACCCAGGCTGCCCCTACCCAGGG + Intergenic
948541671 2:238695387-238695409 ACCCAGGATGAGCGTGCTGAAGG - Intergenic
948564656 2:238876217-238876239 ACCCAGGCAGCCTCTGCAGAGGG + Intronic
948863490 2:240763998-240764020 GCCCTGGAGGGCCCTGCAGATGG - Intronic
1169880468 20:10341534-10341556 ACCCAGGCTGTTCATGCAGAGGG - Intergenic
1171325967 20:24293134-24293156 ACCCTGGAGTCCCCTGCAGAAGG - Intergenic
1171487540 20:25495292-25495314 CCCCAGGGTGAGCCTGCAGATGG - Intronic
1172055267 20:32150436-32150458 ACCCAGTCTTCCCCTGTAGAGGG + Intronic
1172119302 20:32588392-32588414 ACCCAGCATGCCCCTCCTAAAGG - Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175496636 20:59419007-59419029 ACTCGGGATGACACTGCAGACGG + Intergenic
1175740200 20:61414745-61414767 ACTCAGGAAGTCCCTCCAGATGG + Intronic
1175844509 20:62051469-62051491 CCCCAGGCTGCACGTGCAGAGGG + Intronic
1179042704 21:37818004-37818026 ACCCAGAATGCACATGAAGATGG + Intronic
1179510148 21:41867186-41867208 ACACAGAGTGACCCTGCAGAAGG + Intronic
1179578167 21:42320646-42320668 ACCCAGGATGGCTTTGAAGACGG + Intergenic
1179958120 21:44752278-44752300 GCCCAGGAGGCCTCTGCAGGAGG + Intergenic
1180177927 21:46099013-46099035 GCCTAGGACGCCCCTGGAGAAGG + Intronic
1182416879 22:30226980-30227002 ACTCAGGGTGCACCTTCAGAGGG - Intergenic
1182459365 22:30472917-30472939 ACCCAGGATGCCCCAGGAGTAGG - Intergenic
1183759703 22:39804983-39805005 ACCAAGGATGTCCCTGGCGAGGG + Intronic
1184460479 22:44635015-44635037 ACTCAGGAAGCCTCTGCAGAAGG - Intergenic
1185081894 22:48714072-48714094 GCCCAGGGCGGCCCTGCAGAAGG + Intronic
950585610 3:13890300-13890322 ACCCAGGAAGCCCCTGGAGCAGG + Intergenic
953213042 3:40893299-40893321 TCCCAGGAGGCCCCAGCACAGGG + Intergenic
953569244 3:44058186-44058208 ACCCACAATGCCCCTGGAGAGGG - Intergenic
953796835 3:45992365-45992387 ACCCAGGATGGCTCTGAAGCTGG + Intronic
953969289 3:47334576-47334598 TCCCAGGTTTCCCCTGCAGTTGG + Intronic
954036707 3:47854737-47854759 CCCCAGGCAGGCCCTGCAGAGGG + Intronic
954036717 3:47854763-47854785 CCCCAGGCAGGCCCTGCAGAGGG + Intronic
954450596 3:50569370-50569392 TCCCAGGAGACCCCTGCGGATGG - Exonic
954755386 3:52836362-52836384 TCCAGGGGTGCCCCTGCAGATGG + Intronic
956441738 3:69287531-69287553 ATGCAGGATTCCCGTGCAGATGG + Intronic
961591538 3:127985156-127985178 AGCCAGGACTACCCTGCAGATGG - Exonic
961821467 3:129577678-129577700 ACCCAGGACGCGCCTCCAGGAGG + Intronic
962204588 3:133424412-133424434 ACCCAGAATGCACCTGAAAAAGG - Intronic
963836774 3:150066022-150066044 ACCAAGGATGGCACTGCACAAGG - Intergenic
965229269 3:166029526-166029548 ACCCAGGATGTTCCTGCCCAGGG + Intergenic
965822969 3:172703172-172703194 GACTAGCATGCCCCTGCAGAAGG + Intronic
968644292 4:1731240-1731262 AGGCAGGCTGCCCCTGCTGATGG - Exonic
969934269 4:10665774-10665796 TCCCACGTTGCCCCTGAAGAGGG + Intronic
970041770 4:11806493-11806515 AGCCAGGATGAGCCTGGAGAAGG - Intergenic
971867345 4:32189937-32189959 ACCCAGGCTGTTCCTGCGGAGGG - Intergenic
972909438 4:43796851-43796873 TCCCATGCTGCCACTGCAGAAGG - Intergenic
973126088 4:46586726-46586748 CCCCAGGGTGTCCCTGCATAGGG + Intergenic
979721087 4:123901317-123901339 AGCCTGGATGAGCCTGCAGATGG + Intergenic
982292482 4:153792697-153792719 AACGAGGACGCCCCTGCAGCTGG + Intergenic
983447718 4:167876468-167876490 AGCCAGGATGAGCCAGCAGAAGG - Intergenic
983448507 4:167881780-167881802 AGCCAGGATGAGCCAGCAGAAGG - Intergenic
983805348 4:171986336-171986358 AGCCAGGATGACCCAGGAGAAGG + Intronic
984710234 4:182878794-182878816 ACCACCGATGCCCCTGCAGATGG - Intergenic
985721063 5:1489318-1489340 AGCCAGGCTGCCCCTACAGCTGG + Intronic
985947188 5:3194970-3194992 TCCCATGCAGCCCCTGCAGAAGG + Intergenic
986255911 5:6101430-6101452 AGTCAGGATGCCCATGGAGAGGG - Intergenic
987088143 5:14488050-14488072 CCCCAGCAGCCCCCTGCAGAAGG + Exonic
988904501 5:35772276-35772298 TCCCAGGATTCCACTTCAGAGGG - Intronic
988992122 5:36681612-36681634 ACACTGGTTGCCTCTGCAGAAGG - Intronic
989476959 5:41884844-41884866 ACCCACGGTGCCCATGTAGAAGG + Intergenic
990172201 5:53064901-53064923 ACCCAAAATGCCCTTGCAAAGGG - Exonic
991007559 5:61844782-61844804 AACAAGAAGGCCCCTGCAGATGG + Intergenic
993252835 5:85550312-85550334 ACCCAGGAGGCAGCTGCTGACGG + Intergenic
995321604 5:110840671-110840693 ACCTAGCATGCCTCTGCACAGGG + Intergenic
997179649 5:131814879-131814901 AACCTGGATGCCACTGCTGAGGG + Intronic
997441398 5:133911201-133911223 ACCCAGGGTGCCCTTTCACAGGG - Intergenic
997574745 5:134966049-134966071 CCCCAGGAGGCCCCTGTGGATGG + Exonic
998415297 5:141941588-141941610 ACCCAGGCTGGCCCTGCTGATGG - Exonic
998537684 5:142949813-142949835 ACCCTGTATGTCACTGCAGAGGG - Intronic
999380361 5:151117168-151117190 CCTCACGATGCCCCTGCAGCAGG + Exonic
1000023946 5:157342920-157342942 AACCAGGATGCCCCTGATGCGGG - Exonic
1000680221 5:164174474-164174496 AACCAGGATGCCACAGCAGTTGG + Intergenic
1001410487 5:171508055-171508077 ACGCGGGCTGCCCCTGCGGAGGG + Intergenic
1002700172 5:181118564-181118586 GCCCAGGCGGCCCCTGCAGAGGG - Intergenic
1003090402 6:3097281-3097303 AGCCAGGATGCCCTTGAAGAAGG + Intronic
1003224179 6:4189764-4189786 AGCCAGCATGCCCATGCAGGTGG + Intergenic
1003700786 6:8462620-8462642 TTCCTGGATGGCCCTGCAGAAGG + Intergenic
1005422066 6:25661603-25661625 ACCCAAGATGCCTCTAAAGATGG + Exonic
1005775817 6:29129938-29129960 ACCCAGGCTGTTCCTGCCGAGGG - Intergenic
1006517046 6:34550910-34550932 ACCCAGGCTGCCCATGCAGCAGG - Intronic
1006744385 6:36331072-36331094 GCCCAGGAGGCCTCTGCTGAGGG - Intronic
1007105464 6:39280461-39280483 CCCCAGGGAGCCCCTGCAGCAGG - Intergenic
1007172861 6:39876852-39876874 CCCCAGGCTGCCTCTTCAGAGGG - Intronic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1007479767 6:42142314-42142336 ACCCAGGAGGCCCCGGAGGAGGG - Exonic
1013067956 6:106701790-106701812 AGAGAGGATGCCCCTCCAGATGG - Intergenic
1013269910 6:108535748-108535770 ACCCAAGAGGCTCCTGAAGAGGG + Intergenic
1013959044 6:115875724-115875746 AACCAGGCTGCACCAGCAGAAGG - Intergenic
1016915434 6:149240069-149240091 GCCCAGGCTGCCCCTGCTGAAGG + Intronic
1018377974 6:163231584-163231606 AGCCAGGATGCCTCAGCAAAAGG + Intronic
1019501551 7:1367254-1367276 TCCCAGGAATCCCCTGCTGAAGG + Intergenic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1020144942 7:5634963-5634985 AACCAGGTAGCCCTTGCAGAGGG - Intronic
1020849789 7:13337782-13337804 AGCCAGGATCCCCCTACAGCTGG - Intergenic
1022470454 7:30678949-30678971 ACCCAGGCTCCCTCTCCAGATGG + Intronic
1022576137 7:31498639-31498661 ACCCACAAGGCCCCTACAGAGGG - Intergenic
1022861477 7:34371650-34371672 AACTAGGATGCCCGTGTAGATGG - Intergenic
1023939216 7:44759388-44759410 GCACAGGCTGCCCCTGCAGCAGG + Exonic
1026958532 7:74393851-74393873 ACACAGGCTGCATCTGCAGAGGG - Intronic
1031422799 7:121569488-121569510 AGCCAGGATGAGCCAGCAGAAGG + Intergenic
1032192860 7:129774426-129774448 ATTCAGGATGGCCCTACAGATGG + Intergenic
1033804287 7:144937061-144937083 ACCTAGGAATCTCCTGCAGATGG + Intergenic
1034882837 7:154775731-154775753 GCCCAGCATGTCCCTGGAGAAGG + Intronic
1035329065 7:158084781-158084803 ACCCACGATGCCCATCCACACGG + Intronic
1036797692 8:11768321-11768343 CCCCAGGATGCCCCTGCTATAGG - Intergenic
1036798930 8:11775311-11775333 ACCCAGGCTGCTGCTTCAGAGGG - Intronic
1038394623 8:27237701-27237723 AGCCAAGATCCTCCTGCAGATGG - Intronic
1039843754 8:41311158-41311180 ACACAGGAGGCTTCTGCAGATGG + Intergenic
1040711831 8:50198150-50198172 GCCTAGGATGCACCTGCTGAGGG - Intronic
1040905153 8:52461422-52461444 ACTCCGGCAGCCCCTGCAGAAGG - Intergenic
1040985242 8:53286848-53286870 ACCTGGGATGACCCAGCAGAGGG + Intergenic
1047318388 8:123755173-123755195 ACCCAGGCTGTTCATGCAGAGGG + Intergenic
1047543977 8:125797643-125797665 ACCCAGGCTGTCCATGCTGAGGG + Intergenic
1048219245 8:132526387-132526409 ACTCAGGGTGCCACTGCAGGAGG - Intergenic
1048313582 8:133345249-133345271 TCCCAGGATCACTCTGCAGAAGG + Intergenic
1048321069 8:133400550-133400572 AGTCAGGATGCTCCTGCAGGGGG - Intergenic
1048446600 8:134497679-134497701 AGCCAGGATGCCCCCGCTGCTGG + Intronic
1048446629 8:134497797-134497819 AGCCGGGATGCCCCAGCAGCTGG + Intronic
1048446671 8:134497974-134497996 AGCCAGGATGCCCCCGCTGCTGG + Intronic
1048520259 8:135147344-135147366 TCCCAGGAATCCCCTGCATATGG - Intergenic
1050706674 9:8407536-8407558 ATCCAGAATGCCACTGCAAAAGG + Intronic
1052647388 9:31254106-31254128 GGCCAGGTTGCCCCTCCAGAAGG - Intergenic
1056968979 9:91186943-91186965 AAGCTGGATGGCCCTGCAGAGGG - Intergenic
1057732458 9:97622167-97622189 ACCCAGGGTCCCCCTGCTGTGGG + Intronic
1058857996 9:109085212-109085234 ACCCAGGATGCTAGGGCAGAAGG - Intronic
1058969763 9:110070041-110070063 TTCCAGGATGCCCCTCCAGTGGG - Intronic
1060019374 9:120115980-120116002 AACCAGGATGTCCCAGCAGCTGG + Intergenic
1060958778 9:127664302-127664324 AACCAGGAGGCCACTGCAGGAGG + Intronic
1062573351 9:137195469-137195491 ACCCAGGATCTGCCTGCACAGGG + Intronic
1203740069 Un_GL000216v2:171123-171145 AGCCAGGCTGCGCCAGCAGAGGG + Intergenic
1186290204 X:8089030-8089052 ACCCAGGCTTCCACTGCAGAAGG - Intergenic
1188284821 X:28314656-28314678 ACCCAGGATGACAGTGGAGAAGG + Intergenic
1188501711 X:30834050-30834072 ACCCAGGCAGCAGCTGCAGATGG - Exonic
1190758964 X:53423963-53423985 ACCCAGGATGCCGAAGCAGGAGG + Intronic
1190981541 X:55460623-55460645 ACCCAGGCTTACCCTGCAGAAGG - Intergenic
1190987157 X:55512557-55512579 ACCCAGGCTTACCCTGCAGAAGG + Intergenic
1192729647 X:73790291-73790313 ACCCAGGATACCCATGTAGAAGG - Intergenic
1193274446 X:79569902-79569924 ACCCAAGTTGCACCTGTAGAAGG + Intergenic
1193994066 X:88343641-88343663 AGCCAGGATGAGCCAGCAGAAGG + Intergenic
1195166230 X:102223372-102223394 ACGGAGGATGCCCCTGCCGTAGG - Exonic
1195192629 X:102463716-102463738 ACGGAGGATGCCCCTGCCGTAGG + Exonic
1196692686 X:118577229-118577251 GCCCGGGCTGTCCCTGCAGAAGG - Intronic
1197034791 X:121860250-121860272 GCTCATGCTGCCCCTGCAGAAGG - Intergenic
1198307872 X:135400485-135400507 ACCCAGGAGGCCCCTGTACCTGG - Intergenic
1199709412 X:150458270-150458292 AGACAGGATGCCCCTCTAGAAGG + Intronic
1200179077 X:154139432-154139454 TCCCGGGATGCAGCTGCAGATGG - Intergenic