ID: 1175412098

View in Genome Browser
Species Human (GRCh38)
Location 20:58777174-58777196
Sequence TCTCCACCAAGTACACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175412098_1175412106 21 Left 1175412098 20:58777174-58777196 CCACCAGGTGTACTTGGTGGAGA No data
Right 1175412106 20:58777218-58777240 CAGAAAGAACTCAGGCTGCAGGG No data
1175412098_1175412100 -6 Left 1175412098 20:58777174-58777196 CCACCAGGTGTACTTGGTGGAGA No data
Right 1175412100 20:58777191-58777213 TGGAGAGTCTGCCCCAGCTGTGG No data
1175412098_1175412107 30 Left 1175412098 20:58777174-58777196 CCACCAGGTGTACTTGGTGGAGA No data
Right 1175412107 20:58777227-58777249 CTCAGGCTGCAGGGCTGTCCAGG No data
1175412098_1175412105 20 Left 1175412098 20:58777174-58777196 CCACCAGGTGTACTTGGTGGAGA No data
Right 1175412105 20:58777217-58777239 GCAGAAAGAACTCAGGCTGCAGG No data
1175412098_1175412104 13 Left 1175412098 20:58777174-58777196 CCACCAGGTGTACTTGGTGGAGA No data
Right 1175412104 20:58777210-58777232 GTGGACTGCAGAAAGAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175412098 Original CRISPR TCTCCACCAAGTACACCTGG TGG (reversed) Intergenic
No off target data available for this crispr