ID: 1175413307

View in Genome Browser
Species Human (GRCh38)
Location 20:58785477-58785499
Sequence TCCAGGGAAATGCCCACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175413307_1175413319 17 Left 1175413307 20:58785477-58785499 CCCAGTGTGGGCATTTCCCTGGA No data
Right 1175413319 20:58785517-58785539 TGAGCTTCTGGTCGTGTCCTGGG No data
1175413307_1175413313 5 Left 1175413307 20:58785477-58785499 CCCAGTGTGGGCATTTCCCTGGA No data
Right 1175413313 20:58785505-58785527 GTGGCCCTGCCCTGAGCTTCTGG No data
1175413307_1175413320 26 Left 1175413307 20:58785477-58785499 CCCAGTGTGGGCATTTCCCTGGA No data
Right 1175413320 20:58785526-58785548 GGTCGTGTCCTGGGTCACGTAGG No data
1175413307_1175413318 16 Left 1175413307 20:58785477-58785499 CCCAGTGTGGGCATTTCCCTGGA No data
Right 1175413318 20:58785516-58785538 CTGAGCTTCTGGTCGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175413307 Original CRISPR TCCAGGGAAATGCCCACACT GGG (reversed) Intergenic
No off target data available for this crispr