ID: 1175413439

View in Genome Browser
Species Human (GRCh38)
Location 20:58786166-58786188
Sequence TTGTTGATTACTAGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175413420_1175413439 29 Left 1175413420 20:58786114-58786136 CCCCCCCCCCCCCCCGGGGACAT No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413433_1175413439 17 Left 1175413433 20:58786126-58786148 CCCGGGGACATTTGGCAAGTCTA No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413430_1175413439 20 Left 1175413430 20:58786123-58786145 CCCCCCGGGGACATTTGGCAAGT No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413428_1175413439 22 Left 1175413428 20:58786121-58786143 CCCCCCCCGGGGACATTTGGCAA No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413429_1175413439 21 Left 1175413429 20:58786122-58786144 CCCCCCCGGGGACATTTGGCAAG No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413432_1175413439 18 Left 1175413432 20:58786125-58786147 CCCCGGGGACATTTGGCAAGTCT No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413419_1175413439 30 Left 1175413419 20:58786113-58786135 CCCCCCCCCCCCCCCCGGGGACA No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413431_1175413439 19 Left 1175413431 20:58786124-58786146 CCCCCGGGGACATTTGGCAAGTC No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413424_1175413439 25 Left 1175413424 20:58786118-58786140 CCCCCCCCCCCGGGGACATTTGG No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413426_1175413439 24 Left 1175413426 20:58786119-58786141 CCCCCCCCCCGGGGACATTTGGC No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413427_1175413439 23 Left 1175413427 20:58786120-58786142 CCCCCCCCCGGGGACATTTGGCA No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413421_1175413439 28 Left 1175413421 20:58786115-58786137 CCCCCCCCCCCCCCGGGGACATT No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413434_1175413439 16 Left 1175413434 20:58786127-58786149 CCGGGGACATTTGGCAAGTCTAG No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413423_1175413439 26 Left 1175413423 20:58786117-58786139 CCCCCCCCCCCCGGGGACATTTG No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data
1175413422_1175413439 27 Left 1175413422 20:58786116-58786138 CCCCCCCCCCCCCGGGGACATTT No data
Right 1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175413439 Original CRISPR TTGTTGATTACTAGGGATGT GGG Intergenic
No off target data available for this crispr