ID: 1175414352

View in Genome Browser
Species Human (GRCh38)
Location 20:58792077-58792099
Sequence GGGAACAAAAGGAAGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175414352_1175414356 -7 Left 1175414352 20:58792077-58792099 CCTCCTACCTTCCTTTTGTTCCC No data
Right 1175414356 20:58792093-58792115 TGTTCCCCAGAGCCAAGTGAAGG No data
1175414352_1175414360 1 Left 1175414352 20:58792077-58792099 CCTCCTACCTTCCTTTTGTTCCC No data
Right 1175414360 20:58792101-58792123 AGAGCCAAGTGAAGGCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175414352 Original CRISPR GGGAACAAAAGGAAGGTAGG AGG (reversed) Intergenic
No off target data available for this crispr