ID: 1175415324

View in Genome Browser
Species Human (GRCh38)
Location 20:58797098-58797120
Sequence AGGGCCCACCCTCATTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175415321_1175415324 -7 Left 1175415321 20:58797082-58797104 CCACAGTAACCTGTCCAGGGCCC No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data
1175415316_1175415324 -2 Left 1175415316 20:58797077-58797099 CCCACCCACAGTAACCTGTCCAG No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data
1175415314_1175415324 5 Left 1175415314 20:58797070-58797092 CCCAACACCCACCCACAGTAACC No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data
1175415320_1175415324 -6 Left 1175415320 20:58797081-58797103 CCCACAGTAACCTGTCCAGGGCC No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data
1175415315_1175415324 4 Left 1175415315 20:58797071-58797093 CCAACACCCACCCACAGTAACCT No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data
1175415317_1175415324 -3 Left 1175415317 20:58797078-58797100 CCACCCACAGTAACCTGTCCAGG No data
Right 1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175415324 Original CRISPR AGGGCCCACCCTCATTCCCG AGG Intergenic
No off target data available for this crispr