ID: 1175415896

View in Genome Browser
Species Human (GRCh38)
Location 20:58800736-58800758
Sequence GCGAATGAGCAGACAGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175415896_1175415901 21 Left 1175415896 20:58800736-58800758 CCGTCCACTGTCTGCTCATTCGC No data
Right 1175415901 20:58800780-58800802 CTCACTGCCTATTTGCTGTCAGG No data
1175415896_1175415903 29 Left 1175415896 20:58800736-58800758 CCGTCCACTGTCTGCTCATTCGC No data
Right 1175415903 20:58800788-58800810 CTATTTGCTGTCAGGTTCCATGG No data
1175415896_1175415899 -4 Left 1175415896 20:58800736-58800758 CCGTCCACTGTCTGCTCATTCGC No data
Right 1175415899 20:58800755-58800777 TCGCCGCTCGTGTGCTGTGGTGG No data
1175415896_1175415898 -7 Left 1175415896 20:58800736-58800758 CCGTCCACTGTCTGCTCATTCGC No data
Right 1175415898 20:58800752-58800774 CATTCGCCGCTCGTGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175415896 Original CRISPR GCGAATGAGCAGACAGTGGA CGG (reversed) Intergenic
No off target data available for this crispr