ID: 1175416888

View in Genome Browser
Species Human (GRCh38)
Location 20:58807374-58807396
Sequence CCCGGCCCCATGTTGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175416879_1175416888 13 Left 1175416879 20:58807338-58807360 CCCAAAGTGCTGGGATTACAGAC 0: 8926
1: 233921
2: 277195
3: 180913
4: 143944
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416874_1175416888 25 Left 1175416874 20:58807326-58807348 CCACCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416880_1175416888 12 Left 1175416880 20:58807339-58807361 CCAAAGTGCTGGGATTACAGACG 0: 4613
1: 136929
2: 281071
3: 222057
4: 151982
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416872_1175416888 29 Left 1175416872 20:58807322-58807344 CCGCCCACCTCGGCCTCCCAAAG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416873_1175416888 26 Left 1175416873 20:58807325-58807347 CCCACCTCGGCCTCCCAAAGTGC 0: 36192
1: 181118
2: 265840
3: 185597
4: 116247
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416878_1175416888 16 Left 1175416878 20:58807335-58807357 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data
1175416876_1175416888 22 Left 1175416876 20:58807329-58807351 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175416888 Original CRISPR CCCGGCCCCATGTTGTTATT TGG Intergenic
No off target data available for this crispr