ID: 1175417615

View in Genome Browser
Species Human (GRCh38)
Location 20:58812037-58812059
Sequence GGAACAGGGTCTAAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175417615_1175417618 -5 Left 1175417615 20:58812037-58812059 CCAGGCTGCTTAGACCCTGTTCC No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417615_1175417620 10 Left 1175417615 20:58812037-58812059 CCAGGCTGCTTAGACCCTGTTCC No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data
1175417615_1175417623 16 Left 1175417615 20:58812037-58812059 CCAGGCTGCTTAGACCCTGTTCC No data
Right 1175417623 20:58812076-58812098 GGTCACCTCCTCCCTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175417615 Original CRISPR GGAACAGGGTCTAAGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr