ID: 1175417618

View in Genome Browser
Species Human (GRCh38)
Location 20:58812055-58812077
Sequence GTTCCTCTTCTGTCTGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175417610_1175417618 26 Left 1175417610 20:58812006-58812028 CCTGCTCCTCACAGCTGCGGGCA No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417613_1175417618 2 Left 1175417613 20:58812030-58812052 CCACCTTCCAGGCTGCTTAGACC No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417611_1175417618 20 Left 1175417611 20:58812012-58812034 CCTCACAGCTGCGGGCAGCCACC No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417609_1175417618 27 Left 1175417609 20:58812005-58812027 CCCTGCTCCTCACAGCTGCGGGC No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417615_1175417618 -5 Left 1175417615 20:58812037-58812059 CCAGGCTGCTTAGACCCTGTTCC No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data
1175417614_1175417618 -1 Left 1175417614 20:58812033-58812055 CCTTCCAGGCTGCTTAGACCCTG No data
Right 1175417618 20:58812055-58812077 GTTCCTCTTCTGTCTGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175417618 Original CRISPR GTTCCTCTTCTGTCTGCCCT CGG Intergenic
No off target data available for this crispr