ID: 1175417620

View in Genome Browser
Species Human (GRCh38)
Location 20:58812070-58812092
Sequence GCCCTCGGTCACCTCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175417614_1175417620 14 Left 1175417614 20:58812033-58812055 CCTTCCAGGCTGCTTAGACCCTG No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data
1175417615_1175417620 10 Left 1175417615 20:58812037-58812059 CCAGGCTGCTTAGACCCTGTTCC No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data
1175417617_1175417620 -5 Left 1175417617 20:58812052-58812074 CCTGTTCCTCTTCTGTCTGCCCT No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data
1175417616_1175417620 -4 Left 1175417616 20:58812051-58812073 CCCTGTTCCTCTTCTGTCTGCCC No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data
1175417613_1175417620 17 Left 1175417613 20:58812030-58812052 CCACCTTCCAGGCTGCTTAGACC No data
Right 1175417620 20:58812070-58812092 GCCCTCGGTCACCTCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175417620 Original CRISPR GCCCTCGGTCACCTCCTCCC TGG Intergenic
No off target data available for this crispr