ID: 1175419564

View in Genome Browser
Species Human (GRCh38)
Location 20:58822844-58822866
Sequence GGTGGTTCAGGGCCCTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175419564_1175419571 9 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419571 20:58822876-58822898 CCCTACGTGTTCCCGACCTAGGG No data
1175419564_1175419574 14 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419574 20:58822881-58822903 CGTGTTCCCGACCTAGGGCTGGG No data
1175419564_1175419573 13 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419573 20:58822880-58822902 ACGTGTTCCCGACCTAGGGCTGG No data
1175419564_1175419569 8 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419569 20:58822875-58822897 TCCCTACGTGTTCCCGACCTAGG No data
1175419564_1175419578 25 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175419564 Original CRISPR GGTGGTTCAGGGCCCTGTTG TGG (reversed) Intergenic