ID: 1175419569

View in Genome Browser
Species Human (GRCh38)
Location 20:58822875-58822897
Sequence TCCCTACGTGTTCCCGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175419564_1175419569 8 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419569 20:58822875-58822897 TCCCTACGTGTTCCCGACCTAGG No data
1175419566_1175419569 -4 Left 1175419566 20:58822856-58822878 CCTGAACCACCAGCTCTGCTCCC No data
Right 1175419569 20:58822875-58822897 TCCCTACGTGTTCCCGACCTAGG No data
1175419565_1175419569 -3 Left 1175419565 20:58822855-58822877 CCCTGAACCACCAGCTCTGCTCC No data
Right 1175419569 20:58822875-58822897 TCCCTACGTGTTCCCGACCTAGG No data
1175419567_1175419569 -10 Left 1175419567 20:58822862-58822884 CCACCAGCTCTGCTCCCTACGTG No data
Right 1175419569 20:58822875-58822897 TCCCTACGTGTTCCCGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175419569 Original CRISPR TCCCTACGTGTTCCCGACCT AGG Intergenic