ID: 1175419578

View in Genome Browser
Species Human (GRCh38)
Location 20:58822892-58822914
Sequence CCTAGGGCTGGGCTCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175419570_1175419578 -7 Left 1175419570 20:58822876-58822898 CCCTACGTGTTCCCGACCTAGGG No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419567_1175419578 7 Left 1175419567 20:58822862-58822884 CCACCAGCTCTGCTCCCTACGTG No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419564_1175419578 25 Left 1175419564 20:58822844-58822866 CCACAACAGGGCCCTGAACCACC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419566_1175419578 13 Left 1175419566 20:58822856-58822878 CCTGAACCACCAGCTCTGCTCCC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419565_1175419578 14 Left 1175419565 20:58822855-58822877 CCCTGAACCACCAGCTCTGCTCC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419568_1175419578 4 Left 1175419568 20:58822865-58822887 CCAGCTCTGCTCCCTACGTGTTC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data
1175419572_1175419578 -8 Left 1175419572 20:58822877-58822899 CCTACGTGTTCCCGACCTAGGGC No data
Right 1175419578 20:58822892-58822914 CCTAGGGCTGGGCTCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175419578 Original CRISPR CCTAGGGCTGGGCTCTGACC TGG Intergenic