ID: 1175420117

View in Genome Browser
Species Human (GRCh38)
Location 20:58826542-58826564
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175420117_1175420125 0 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420125 20:58826565-58826587 TGGATTAGCAGAGGGGACCTGGG No data
1175420117_1175420127 18 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420127 20:58826583-58826605 CTGGGTTTAAAATGATCAGATGG No data
1175420117_1175420129 24 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420129 20:58826589-58826611 TTAAAATGATCAGATGGTGAGGG No data
1175420117_1175420121 -8 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420121 20:58826557-58826579 TTAGATCCTGGATTAGCAGAGGG No data
1175420117_1175420122 -7 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420122 20:58826558-58826580 TAGATCCTGGATTAGCAGAGGGG No data
1175420117_1175420124 -1 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG No data
1175420117_1175420120 -9 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420120 20:58826556-58826578 TTTAGATCCTGGATTAGCAGAGG No data
1175420117_1175420128 23 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420128 20:58826588-58826610 TTTAAAATGATCAGATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175420117 Original CRISPR GGATCTAAACAGTTTAAGCC GGG (reversed) Intergenic
No off target data available for this crispr