ID: 1175420124

View in Genome Browser
Species Human (GRCh38)
Location 20:58826564-58826586
Sequence CTGGATTAGCAGAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175420116_1175420124 4 Left 1175420116 20:58826537-58826559 CCATTCCCGGCTTAAACTGTTTA No data
Right 1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG No data
1175420117_1175420124 -1 Left 1175420117 20:58826542-58826564 CCCGGCTTAAACTGTTTAGATCC No data
Right 1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG No data
1175420118_1175420124 -2 Left 1175420118 20:58826543-58826565 CCGGCTTAAACTGTTTAGATCCT No data
Right 1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175420124 Original CRISPR CTGGATTAGCAGAGGGGACC TGG Intergenic
No off target data available for this crispr