ID: 1175420179

View in Genome Browser
Species Human (GRCh38)
Location 20:58827000-58827022
Sequence TAACATAGTTCAGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175420179_1175420181 9 Left 1175420179 20:58827000-58827022 CCGCACCTGGCTGAACTATGTTA No data
Right 1175420181 20:58827032-58827054 CAGCTCAGTCACCTTCATGAAGG No data
1175420179_1175420183 24 Left 1175420179 20:58827000-58827022 CCGCACCTGGCTGAACTATGTTA No data
Right 1175420183 20:58827047-58827069 CATGAAGGACTAAAAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175420179 Original CRISPR TAACATAGTTCAGCCAGGTG CGG (reversed) Intergenic
No off target data available for this crispr