ID: 1175423342

View in Genome Browser
Species Human (GRCh38)
Location 20:58849765-58849787
Sequence CCTAGCACGGTGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175423342 Original CRISPR CCTAGCACGGTGAAGGAAGC AGG (reversed) Intronic
901196827 1:7445034-7445056 CCTAGCACGGGGTAGGAGGTGGG + Intronic
902137918 1:14326674-14326696 CCAAGCACAGGGAAGGATGCAGG - Intergenic
903904315 1:26672992-26673014 CCTAGCACTTTGAAGGGAGAAGG - Intergenic
906411820 1:45584643-45584665 CCTTGCACGAGGAAGGAGGCTGG + Intronic
907440805 1:54476866-54476888 TCTAGCACAGAGGAGGAAGCAGG + Intergenic
910130045 1:83893783-83893805 CCCATCACAGTGCAGGAAGCTGG - Intronic
910837480 1:91530325-91530347 GTTAGCTAGGTGAAGGAAGCTGG - Intergenic
911069580 1:93822010-93822032 CCAAGCAAGGTTAGGGAAGCTGG + Intronic
913212318 1:116591808-116591830 CCTAGCTCTGTGGAGGAAGGTGG - Intronic
913966329 1:143380428-143380450 CCTAGCAAACTGAAGGAACCTGG - Intergenic
914060703 1:144206035-144206057 CCTAGCAAACTGAAGGAACCTGG - Intergenic
914118447 1:144760334-144760356 CCTAGCAAACTGAAGGAACCTGG + Intergenic
920136665 1:203774937-203774959 CCTAGAACTGTGAAGAAAGCAGG + Exonic
1067791781 10:49293720-49293742 ACTAACACGGTGGTGGAAGCAGG - Intergenic
1068062095 10:52081026-52081048 CCTATTGGGGTGAAGGAAGCCGG - Intronic
1074784678 10:116828473-116828495 CCCAGGACAGTGCAGGAAGCTGG - Intergenic
1075666248 10:124233120-124233142 TCTAGCTCGGGGCAGGAAGCTGG - Intergenic
1075688460 10:124379756-124379778 CCTTGCACGGTGATGGGGGCGGG + Intergenic
1076753445 10:132555244-132555266 CCCAGCACGGTGAAGGAACAGGG - Intronic
1078083268 11:8218893-8218915 CCAGGCACGGTGCTGGAAGCAGG - Intergenic
1084551408 11:69845235-69845257 CCAGGCAGGGGGAAGGAAGCTGG - Intergenic
1086373943 11:86181578-86181600 CCTGGCATGTTGAAGGAAGATGG + Intergenic
1086398721 11:86443277-86443299 CCAAGCACGTGGAAGGAGGCTGG - Intronic
1087398220 11:97630660-97630682 CCTAGCAAGGTAAAGTTAGCTGG - Intergenic
1090350136 11:126102736-126102758 CCTAGCAAGGAGCAGGAGGCAGG + Intergenic
1090408187 11:126489936-126489958 CCTGGCACTGTGCAGGAATCTGG + Intronic
1105215564 13:18282431-18282453 CCTAGCTCTGTGGAGGAAGGTGG - Intergenic
1105997546 13:25686822-25686844 CCAAGCAGGGTTTAGGAAGCAGG - Intronic
1106184443 13:27396714-27396736 CCTGGCACTGTGAATGATGCAGG - Intergenic
1107892095 13:44922802-44922824 CCAAGCACTGTGCTGGAAGCTGG - Intergenic
1112673039 13:101663471-101663493 CCAAGCACTGTGATGGCAGCTGG - Intronic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1122925419 14:104897361-104897383 CCTAGCAGGGAGAAGGAACTGGG - Intergenic
1126183448 15:45808527-45808549 CTTAGCACCTTGAAGGCAGCAGG - Intergenic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1128780559 15:70356218-70356240 TCACGCAGGGTGAAGGAAGCTGG + Intergenic
1128976892 15:72160873-72160895 CCTAGCACAGTGCAGGAACCAGG - Exonic
1131799330 15:96053248-96053270 CCGAGCCAGGTGAAGAAAGCTGG + Intergenic
1132788010 16:1668910-1668932 CCCACCACGGAGAAGGCAGCAGG - Intronic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1133814723 16:9188003-9188025 CCTACCAGGATGAAGGAAGGAGG - Intergenic
1138101270 16:54253990-54254012 TCTGGCACGGTGGAGGCAGCAGG + Intronic
1141935867 16:87237275-87237297 TCTAGCACTCTGAAGGAAGTGGG + Intronic
1145050439 17:19655465-19655487 CCTAACACGGTAACTGAAGCTGG - Intronic
1145306088 17:21676032-21676054 ACTGGGACGGAGAAGGAAGCTGG - Intergenic
1145778670 17:27547102-27547124 CCTAGTACCCTGAAGGGAGCAGG + Intronic
1148219042 17:45849482-45849504 CCAAGCACAGTGCAGCAAGCTGG - Intergenic
1151326017 17:73380176-73380198 CCTACCCAGGGGAAGGAAGCAGG - Intronic
1152046608 17:77940800-77940822 CCAAGCACGGTGCAGGCATCGGG + Intergenic
1152088829 17:78236089-78236111 CCTAGCACCGTGATAGGAGCAGG + Intronic
1154064826 18:11096921-11096943 CCTATCCTGGAGAAGGAAGCTGG + Intronic
1157410552 18:47459444-47459466 CCTAGAACCGGGAAGGAAGAAGG + Intergenic
1159946108 18:74445906-74445928 CCTAGCTGGGTGAAGGGAGAGGG + Intronic
1160567072 18:79792826-79792848 CCACGCACGGGGAAGGCAGCGGG + Intergenic
1162462008 19:10818873-10818895 CCTAGCTCAGAGAGGGAAGCTGG - Intronic
1162823511 19:13237248-13237270 CCCAGCAGGGTGAAGGCAGGAGG + Intronic
1164676986 19:30107508-30107530 CCCAGCAAGGGGAAGGAAGGGGG + Intergenic
1165912433 19:39237489-39237511 GCTAGCCCAGTGAAGGAAGCTGG + Intergenic
1165913620 19:39244691-39244713 GCTAGCCCAGTGAAGGAAGCTGG + Intronic
1165917342 19:39268933-39268955 GCTAGCCCAGTGAAGGAAGCTGG - Intronic
1167506734 19:49874832-49874854 CCCACCAGGGTGAAGGGAGCAGG + Intronic
1167557826 19:50206538-50206560 CCTTGCACTCTGAAGGCAGCAGG - Intronic
1202700110 1_KI270712v1_random:157923-157945 CCTAGCAAACTGAAGGAACCTGG - Intergenic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
928190995 2:29168034-29168056 CCTAGGAAGGTGGAGGACGCAGG - Intronic
928999596 2:37332985-37333007 CCTACTCCGCTGAAGGAAGCGGG + Intergenic
932750979 2:74371536-74371558 CCTTGGATGGGGAAGGAAGCGGG + Exonic
934171043 2:89541398-89541420 CCTAGCAAACTGAAGGAACCTGG - Intergenic
934298764 2:91764294-91764316 CCTAGCTCTGTGGAGGAAGGTGG + Intergenic
937059792 2:118972414-118972436 CCTTGCAAAGTGATGGAAGCAGG + Intronic
937450809 2:122000816-122000838 TCTAGCACTGTGAAGAAAGACGG + Intergenic
937950219 2:127380147-127380169 CCTAGCACAGTGCAGACAGCAGG - Intronic
938602147 2:132853376-132853398 CTAAGCCAGGTGAAGGAAGCAGG - Intronic
940893501 2:159057749-159057771 CAAAGCCTGGTGAAGGAAGCAGG + Intronic
946616809 2:221518793-221518815 CCTAACACGGGTAAGCAAGCAGG + Intronic
1169702042 20:8457504-8457526 TCTAGCAGTGTGATGGAAGCTGG - Intronic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1170679051 20:18508623-18508645 CCTAGAAGGGTGAGGGAAACAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171523592 20:25793536-25793558 ACTGGGACGGAGAAGGAAGCTGG - Intronic
1171531339 20:25855493-25855515 ACTGGGACGGAGAAGGAAGCTGG - Intronic
1171553235 20:26062347-26062369 ACTGGGACGGAGAAGGAAGCTGG + Intergenic
1172222213 20:33281752-33281774 CCCAGCACGTGGCAGGAAGCAGG + Intronic
1174643558 20:52066346-52066368 CCTGGCACGGTGGAGGCAACAGG - Intronic
1175423342 20:58849765-58849787 CCTAGCACGGTGAAGGAAGCAGG - Intronic
1179156008 21:38851830-38851852 CTTAGCAGAGGGAAGGAAGCTGG - Intergenic
1180705176 22:17805085-17805107 CCTCAGACGGTGATGGAAGCTGG + Intronic
1182668698 22:31977632-31977654 CCTAGCACAGTGATGTCAGCTGG - Intergenic
950548368 3:13652405-13652427 CCTAGCACCGTGCATAAAGCAGG + Intergenic
954572934 3:51657422-51657444 CCAAGGAAGGTGAAGCAAGCAGG - Intronic
959673397 3:109005668-109005690 GCTAGCAAGGGGCAGGAAGCAGG - Intronic
961603857 3:128079229-128079251 ACCAGCCAGGTGAAGGAAGCGGG - Intronic
963785649 3:149531837-149531859 CCTAGCACTGTTAAGGTAGTTGG - Intronic
967234305 3:187369216-187369238 CCTAACATGGTCAAGGAAACTGG - Intronic
968377435 4:54737-54759 CCTGGGTGGGTGAAGGAAGCAGG - Intronic
968944207 4:3655056-3655078 CCCATCACAGAGAAGGAAGCAGG - Intergenic
969028728 4:4194488-4194510 CCTAGCAAACTGAAGGAAGCCGG + Intronic
970158790 4:13168593-13168615 CCCAGCCCGGTGAATGAGGCAGG - Intergenic
992518802 5:77525619-77525641 CCCTGCAAGGTGAAGGAAGAGGG - Intronic
995138168 5:108702682-108702704 CCTACCAAGGGCAAGGAAGCCGG - Intergenic
998475350 5:142416675-142416697 CCTAGGAAGGTGAAAGCAGCAGG + Intergenic
999770738 5:154773783-154773805 CCTACCCCGCTGATGGAAGCAGG + Intronic
1002021394 5:176366156-176366178 CCGAGACCGGTGGAGGAAGCGGG + Intronic
1007110913 6:39313227-39313249 CCTAGCAGGGCGGAGGAGGCCGG - Intronic
1007186080 6:39973407-39973429 CCTAGAACAGCAAAGGAAGCTGG - Intergenic
1009430581 6:63561153-63561175 CCTAACAGAGTGATGGAAGCAGG + Intronic
1013349131 6:109290312-109290334 CTTGGGAAGGTGAAGGAAGCCGG + Intergenic
1026927746 7:74205687-74205709 CCCAGGCCCGTGAAGGAAGCAGG + Intronic
1029448304 7:100626980-100627002 CCTAGCATGGGGAAGGGGGCTGG + Intronic
1032082355 7:128866056-128866078 CCGAGCAAGGTGGGGGAAGCAGG - Intronic
1032130340 7:129222802-129222824 CCTGGCAAGGAGAAGGAAGGAGG - Intergenic
1034424123 7:151005358-151005380 CCTCCCAGGGGGAAGGAAGCTGG - Intronic
1035551635 8:532262-532284 CCTTGCAGGGTGAAGGATGCTGG + Intronic
1035743155 8:1944166-1944188 GGTAGCACGGTGCGGGAAGCTGG - Intronic
1036602150 8:10271271-10271293 CCTACCATGGGGAAGCAAGCAGG + Intronic
1037436091 8:18865100-18865122 CCTAGCACAGTGAATGAATCCGG + Intronic
1040486583 8:47878487-47878509 CCTGGCATGGTGAAGGAGGGGGG - Intronic
1044641518 8:94387382-94387404 ACTTGCAGGGTGAAGGTAGCAGG - Intronic
1045216487 8:100154202-100154224 CCAAGCAAAGTGAATGAAGCAGG + Intergenic
1046738942 8:117808634-117808656 CCTGGCACTGTGATGGTAGCTGG + Intronic
1048469064 8:134691181-134691203 CCTAGCATGGTGAGGGAAAAGGG - Intronic
1049758894 8:144322979-144323001 CCCAGCACCGTGACGGGAGCAGG + Intronic
1049889459 9:55084-55106 TATAGCACGGTGAAGGAAATAGG - Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1056335059 9:85560171-85560193 CTTAGCAAAGTGAAGGAAGTTGG - Intronic
1061545086 9:131299766-131299788 CCTGGCACTGTGAACGAGGCTGG - Intronic
1203571800 Un_KI270744v1:139509-139531 CCTGGGTGGGTGAAGGAAGCAGG + Intergenic
1187717985 X:22122793-22122815 GCTAGCCGGCTGAAGGAAGCAGG - Intronic
1190862162 X:54355472-54355494 CCTAGCTTGGTGGAGGATGCTGG + Intronic
1193208328 X:78775417-78775439 CCTAGCTCTGTGAAGGACGGTGG + Intergenic