ID: 1175424051

View in Genome Browser
Species Human (GRCh38)
Location 20:58853319-58853341
Sequence GCTGTTCCCCGATTTCAGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424051_1175424065 20 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424051_1175424070 27 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424051_1175424056 -5 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424051_1175424060 5 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424051_1175424062 7 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424051_1175424069 26 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424051_1175424061 6 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424051_1175424057 -2 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424051 Original CRISPR GCTGTTCCCCGATTTCAGGG GGG (reversed) Exonic
901543271 1:9935623-9935645 GATGTTCACCTATTTCAGAGAGG - Exonic
916118213 1:161506131-161506153 GCAGTTCCCCCATTTTAGTGGGG + Intronic
918582285 1:186145498-186145520 GCTCTTCCCCCATTGGAGGGAGG - Exonic
919018934 1:192078037-192078059 CCTTTTCCCTGATTTCTGGGAGG - Intergenic
1065101170 10:22334722-22334744 CCTGTACCCCGAGTTCAGCGCGG + Intergenic
1075378492 10:121998662-121998684 GCTGTTCCCTGACTTGAGTGTGG - Intronic
1076999327 11:314826-314848 GGTGGTCCCTGATCTCAGGGCGG + Intronic
1077000541 11:320074-320096 GGTGGTCCCTGATCTCAGGGCGG - Intronic
1078618807 11:12889232-12889254 ACTGGACCCTGATTTCAGGGAGG - Intronic
1084212188 11:67629423-67629445 GCTGTTTCCCGCTTAGAGGGCGG - Intronic
1096475155 12:51905139-51905161 GCTGTTCCCCATATTCAGTGAGG - Intergenic
1116939402 14:50775380-50775402 GCTGTTCCCTGCTTTCATGAAGG - Intronic
1127166778 15:56251838-56251860 TCTGTTCCTGGATTTCTGGGTGG - Intronic
1130966939 15:88705041-88705063 GCTGGTCTGCCATTTCAGGGAGG + Intergenic
1141397357 16:83716914-83716936 GCTGTTACCCCATTTCAAAGAGG - Intronic
1141592388 16:85077482-85077504 GCTGTTTGCGGATTTCAGGTAGG - Exonic
1146013306 17:29213010-29213032 GATGTTCCAGGATTCCAGGGAGG + Intergenic
1150373399 17:64661510-64661532 GCTGTTCCCCGAGCCCCGGGAGG + Intronic
1150778819 17:68102257-68102279 GCTGTTCCCCGAGCCCCGGGAGG - Intergenic
1159483753 18:69026614-69026636 GCTTTTCTCTGACTTCAGGGAGG - Intronic
1162731967 19:12723733-12723755 GCTGTTCCCCTCCTTCAGGCAGG - Intronic
1163426798 19:17244807-17244829 GCTGTGCCCCTATCTCAGAGGGG + Intronic
928470712 2:31573087-31573109 CCTGTTCCCAGATTTCTGGGTGG - Intronic
934716201 2:96546043-96546065 GCTGCTGACTGATTTCAGGGTGG - Intronic
937371067 2:121297599-121297621 GCTGTTCTCTGATCTCAGCGGGG - Intergenic
946042719 2:216796242-216796264 GCTCTTCCCCTATTTCTGTGAGG - Intergenic
1174861297 20:54093971-54093993 GCAGCCCTCCGATTTCAGGGAGG - Intergenic
1175424051 20:58853319-58853341 GCTGTTCCCCGATTTCAGGGGGG - Exonic
1178281312 21:31285241-31285263 GCTCTTCCCTGATTCCAGAGTGG - Intronic
950115183 3:10446114-10446136 GCTGTTACCCCATTTTATGGAGG - Intronic
965602197 3:170466625-170466647 GCTGCTCCCCGAGGTCAGGGTGG - Exonic
966313700 3:178622769-178622791 GCTGTACTCAGATTTCAGGTGGG - Intronic
968502460 4:957273-957295 ACTGTTCCCGGCTTTCTGGGTGG + Intronic
970221015 4:13811098-13811120 GCTCTTCACCCATTTCAGTGTGG + Intergenic
982670648 4:158316587-158316609 GCATTTACCTGATTTCAGGGAGG + Intronic
985651193 5:1108549-1108571 GTTGTGCCCAGATTTCAGGAGGG - Intronic
993209594 5:84931442-84931464 GGTATTCCCTGATTTTAGGGTGG - Intergenic
995817708 5:116191094-116191116 GCTATTTCCAGATTTCAGAGGGG + Intronic
996742468 5:126813653-126813675 GCTGTTCCCCGATTTATAGATGG + Intronic
999241529 5:150130609-150130631 TCTGTTCCCCACTGTCAGGGTGG + Exonic
1001655837 5:173348785-173348807 GCTGTTCTCTGCTTCCAGGGTGG - Intergenic
1011665800 6:89631979-89632001 ACTGTTCCCCAACTTCATGGAGG + Intronic
1014546879 6:122745397-122745419 GCTGTTCCCCCGCTTCCGGGAGG - Intergenic
1014706067 6:124749187-124749209 GCTGTTGCTGGATTTCAGGATGG - Intronic
1015725376 6:136294150-136294172 TCTGTTGCCCCATTTTAGGGGGG - Intergenic
1019281871 7:204689-204711 GCTGTTCTCAGTGTTCAGGGAGG + Intronic
1019281899 7:204831-204853 GCTGTTCTCAGTGTTCAGGGAGG + Intronic
1020692081 7:11368358-11368380 GCTGCTCCCCGACTTCATGCAGG - Intergenic
1028806884 7:95038230-95038252 CCTGTCTCCAGATTTCAGGGAGG - Intronic
1031177594 7:118372304-118372326 GCTGTTCCCTGAATACAGTGAGG - Intergenic
1046097374 8:109577673-109577695 GCTGTTTCAGGAGTTCAGGGAGG - Intronic
1061232038 9:129320762-129320784 TCTGTTCCCCGCTTTCGGGCGGG + Intergenic
1196285930 X:113880383-113880405 GCTGGTGCCAGATTTCAGGTAGG + Intergenic
1197858798 X:130948137-130948159 GAGGTTACCCAATTTCAGGGAGG - Intergenic