ID: 1175424052

View in Genome Browser
Species Human (GRCh38)
Location 20:58853320-58853342
Sequence GGCTGTTCCCCGATTTCAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424052_1175424061 5 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424052_1175424060 4 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424052_1175424062 6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424052_1175424069 25 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424052_1175424056 -6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424052_1175424065 19 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424052_1175424070 26 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424052_1175424057 -3 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424052 Original CRISPR GGCTGTTCCCCGATTTCAGG GGG (reversed) Exonic