ID: 1175424052

View in Genome Browser
Species Human (GRCh38)
Location 20:58853320-58853342
Sequence GGCTGTTCCCCGATTTCAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424052_1175424061 5 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424052_1175424069 25 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424052_1175424062 6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424052_1175424070 26 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424052_1175424057 -3 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424052_1175424056 -6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424052_1175424060 4 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424052_1175424065 19 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424052 Original CRISPR GGCTGTTCCCCGATTTCAGG GGG (reversed) Exonic
903741833 1:25562867-25562889 GGCTGTTCCCATTTTTCAGATGG - Intronic
904447724 1:30588451-30588473 GGGTGTTCCCCCATTTGAGCTGG + Intergenic
909643090 1:77888538-77888560 GCCTGTTCCCGCATTCCAGGCGG - Intronic
912680626 1:111726830-111726852 GGCTTCTCCCCGCTTTCTGGGGG + Exonic
916118212 1:161506130-161506152 GGCAGTTCCCCCATTTTAGTGGG + Intronic
920021118 1:202957753-202957775 GGCTGTTCCCCGCTGAGAGGCGG + Intronic
1062910352 10:1208292-1208314 GGATGTTCCCCCAGTTCTGGAGG + Intronic
1081050316 11:38332019-38332041 GGCTTTTCCCCGTTTTCCTGAGG + Intergenic
1083180615 11:60982473-60982495 GGGTGTTCACCTCTTTCAGGAGG + Intronic
1090441770 11:126730341-126730363 GATTGTTCCCTGATTTCTGGTGG - Intronic
1091434764 12:463649-463671 AGCTGTGCCCCCATTTCAAGAGG - Intronic
1096155863 12:49341301-49341323 GGCTGTTCTCCGACTGCAGCTGG + Intergenic
1106189165 13:27435890-27435912 GGCTGTTTCCCTTTTTTAGGAGG - Exonic
1107711439 13:43154025-43154047 GGTTGTTCCACGATGTCCGGTGG - Intergenic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1138279880 16:55764634-55764656 GGCTGGACCCAGATTCCAGGTGG - Intergenic
1138288618 16:55829015-55829037 GGCTGGACCCAGATTCCAGGTGG + Intronic
1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG + Intronic
1164041137 19:21493681-21493703 GCCTGTCCCCTGCTTTCAGGAGG + Intergenic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164312307 19:24056795-24056817 GTCTGTGCCCTGGTTTCAGGAGG + Intronic
1164977009 19:32581086-32581108 CCCGATTCCCCGATTTCAGGCGG - Exonic
1165279767 19:34786018-34786040 GGCAGAACCCCCATTTCAGGAGG + Intergenic
925316516 2:2930695-2930717 GGCTTTACCCTGAGTTCAGGTGG - Intergenic
932286063 2:70532799-70532821 TGCTGTTCCCTGATTGTAGGTGG + Intronic
934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG + Intronic
942320680 2:174733040-174733062 GGGTGATCCCCGACTTCAGGTGG - Intergenic
942701769 2:178719340-178719362 GGCTCAGCCCCGATTTCAGTTGG - Exonic
944100114 2:196016131-196016153 GTCTGTTAGACGATTTCAGGAGG - Intronic
947676565 2:231986533-231986555 AGCTGTTCCCAGATTAAAGGAGG - Intronic
1170064713 20:12298924-12298946 GCCGGTTCCCAGACTTCAGGTGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1176289568 21:5036958-5036980 GGCTGTTCCTCGGCTTCAGCGGG + Intronic
1177124830 21:17182527-17182549 GGCTGTTCCAGGGTTTGAGGAGG - Intergenic
1179072183 21:38082012-38082034 GGCTGTTCCCTATTTTCAGGAGG + Intronic
1179284712 21:39967504-39967526 GGCTGTTAACCGATTGGAGGAGG + Intergenic
1179867662 21:44226629-44226651 GGCTGTTCCTCGGCTTCAGCGGG - Intronic
1180064882 21:45407159-45407181 GACTGTTTTCCCATTTCAGGGGG - Intronic
1182451188 22:30422919-30422941 GGCTTTTCCCAGGTCTCAGGAGG + Exonic
966313701 3:178622770-178622792 TGCTGTACTCAGATTTCAGGTGG - Intronic
968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG + Intronic
968898400 4:3418592-3418614 GGCTGCTCCCCGCCTGCAGGGGG + Intronic
969132738 4:5003680-5003702 GGCTTATCAGCGATTTCAGGTGG + Intergenic
973993471 4:56435005-56435027 GGCTCCTCCCCGACTGCAGGCGG - Intronic
979136444 4:117117245-117117267 GGCTGTTGCAGGATTTAAGGAGG + Intergenic
985651194 5:1108550-1108572 CGTTGTGCCCAGATTTCAGGAGG - Intronic
999737059 5:154520979-154521001 GCCTCTTCCCTGATGTCAGGAGG - Intergenic
1002202630 5:177538824-177538846 GGCTGTTCCCTGTCCTCAGGTGG - Intronic
1004316776 6:14595537-14595559 GGCTGTTCCCTTATTTGCGGTGG + Intergenic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1007686091 6:43668160-43668182 GGCTTTTCCCCGAGTCCTGGAGG + Intronic
1007988945 6:46234900-46234922 GGCTGTTTCCCATTCTCAGGAGG + Intronic
1010272192 6:73927236-73927258 GTGTGTTCCCAGAATTCAGGTGG - Intergenic
1017488691 6:154925375-154925397 GTCTGTTCCCCGATCTGGGGTGG + Intronic
1023028295 7:36071783-36071805 GGCTGTTCCCATATTTCAATAGG + Intergenic
1031392646 7:121234498-121234520 GGCTGTTCCTCCATTCTAGGAGG - Intronic
1032081285 7:128859767-128859789 GGCTGTTGCAGGAGTTCAGGAGG - Intergenic
1035252052 7:157604037-157604059 GGCTGTTCTCCGCCTTCAGCAGG + Exonic
1048018945 8:130520579-130520601 TGCTGTTCCACCATTTCAGTCGG + Intergenic
1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG + Intergenic
1051689278 9:19692280-19692302 GTCTGTTCCCAGAGTTCAAGTGG - Intronic
1061232037 9:129320761-129320783 TTCTGTTCCCCGCTTTCGGGCGG + Intergenic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG + Intronic