ID: 1175424053

View in Genome Browser
Species Human (GRCh38)
Location 20:58853321-58853343
Sequence GGGCTGTTCCCCGATTTCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424053_1175424060 3 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424053_1175424056 -7 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424053_1175424057 -4 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424053_1175424070 25 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424053_1175424062 5 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424053_1175424065 18 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424053_1175424069 24 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424053_1175424061 4 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424053 Original CRISPR GGGCTGTTCCCCGATTTCAG GGG (reversed) Exonic
900163779 1:1236701-1236723 GGCCTGCTCCCTGGTTTCAGGGG + Intergenic
902524153 1:17043783-17043805 GGGCTGTTCCAAGCTTCCAGAGG - Intronic
909787238 1:79629489-79629511 GGTCTGTCTCCCAATTTCAGAGG + Intergenic
912448356 1:109753965-109753987 GGGCTGTACCCCTAGTACAGTGG + Intronic
916118211 1:161506129-161506151 GGGCAGTTCCCCCATTTTAGTGG + Intronic
916887429 1:169083607-169083629 GGGCAGCTCCCAGATGTCAGGGG - Intergenic
917453093 1:175163463-175163485 GGGCTGTTCCCAGGCCTCAGAGG - Intronic
919944507 1:202309528-202309550 GGGCTCTGCCCTGATTCCAGGGG - Intronic
921132310 1:212230202-212230224 GGAATGTCCCCAGATTTCAGAGG - Intergenic
1065722914 10:28643437-28643459 GGGCTCTTCCCCAACTGCAGTGG - Intergenic
1065905232 10:30245129-30245151 GCCCTGCTCCCTGATTTCAGGGG + Intergenic
1067112931 10:43413368-43413390 GGGTTGTTACCAGGTTTCAGTGG - Intergenic
1070918042 10:80167382-80167404 GGGCTGTTCCCAGAGTCTAGGGG - Intronic
1076058428 10:127394188-127394210 AGGCTGTTTCTTGATTTCAGAGG - Intronic
1076348567 10:129798137-129798159 TGGCTGTGCCCCCATCTCAGAGG - Intergenic
1077902582 11:6501504-6501526 TATCTGTCCCCCGATTTCAGAGG - Intronic
1081582162 11:44359836-44359858 TGGCAGTTCCTCCATTTCAGAGG - Intergenic
1083033683 11:59616405-59616427 GCGCTCTTCTCCGATTTCATTGG - Intergenic
1083606447 11:63981724-63981746 GGGCTGTTCCCAGCTTCTAGAGG - Intronic
1090791717 11:130095900-130095922 GGGCTGTTCCCAGATAACAGTGG + Intronic
1096154624 12:49335098-49335120 GGGCTATTCCCCGAAAACAGAGG + Intronic
1106352204 13:28942860-28942882 GTGCTGTTTCCTGATTCCAGTGG + Intronic
1115478851 14:33842054-33842076 GGGCTGTTCCCAGATGGCATGGG + Intergenic
1122199831 14:100115663-100115685 GGTCTGTTGCAGGATTTCAGTGG + Intronic
1122594863 14:102883155-102883177 CGGCTGTTTCCAGATTTCTGCGG - Intronic
1127137877 15:55943598-55943620 GAGCTCTTCCTAGATTTCAGAGG + Intronic
1138332073 16:56223265-56223287 GGGCTGTTCCCAGGTTCTAGAGG + Intronic
1138732421 16:59209537-59209559 GGGCTGTTCCCCGCTTTGCTCGG + Intergenic
1141564987 16:84895320-84895342 GGTCTGTGCCCCAAGTTCAGTGG - Intronic
1141635294 16:85311141-85311163 GGGCTGGTCCCAAATTCCAGAGG + Intergenic
1142428600 16:90013830-90013852 GGGCTGTGCTCCCATTTTAGGGG + Intronic
1143461000 17:7103344-7103366 AGGCTGCTCCCCAAATTCAGAGG + Intronic
1145012548 17:19378133-19378155 GGGCAGTTCCCCGAGCTCACGGG + Intronic
1146209479 17:30930964-30930986 GGTCTATTCCCCAAATTCAGAGG + Intronic
1152605719 17:81288746-81288768 GGGCTGTTGCTGGAGTTCAGTGG - Intronic
1155761713 18:29576286-29576308 GGGCTGTTCCCAGGTTCTAGAGG + Intergenic
1162723358 19:12675463-12675485 GGGCTGTACCCTGGTTTCTGAGG - Intronic
1163426796 19:17244805-17244827 GTGCTGTGCCCCTATCTCAGAGG + Intronic
943774238 2:191747882-191747904 GGGCTGTTCCTCAATTAGAGAGG - Intergenic
947461612 2:230308631-230308653 GGGCTGTCCCCTGCTTCCAGAGG + Intronic
947470694 2:230398832-230398854 GGGCTGTCCCCGGCTTCCAGAGG + Intronic
948473949 2:238204259-238204281 GGCCAGCTCCCCGATGTCAGTGG - Intergenic
948645475 2:239401229-239401251 GGGCTGTGCGCAGGTTTCAGCGG - Intronic
1169445490 20:5667760-5667782 GGGCTGTTCCCTGCTTCTAGAGG - Intergenic
1175424053 20:58853321-58853343 GGGCTGTTCCCCGATTTCAGGGG - Exonic
1176289567 21:5036957-5036979 GGGCTGTTCCTCGGCTTCAGCGG + Intronic
1179116344 21:38496337-38496359 GGGCTGTTTCCTAATTCCAGTGG + Intronic
1179867663 21:44226630-44226652 GGGCTGTTCCTCGGCTTCAGCGG - Intronic
1182095572 22:27623116-27623138 GAGCAGTTCCAGGATTTCAGGGG + Intergenic
950935689 3:16836634-16836656 GGCCTTTTCCCTGATTTCAGGGG - Intronic
985900688 5:2788066-2788088 GGGCTGTTCCCTGATGTGGGTGG - Intergenic
987228467 5:15868162-15868184 GGGCTGCTCCCTGATTCTAGAGG - Intronic
987326245 5:16813930-16813952 GGGCTGTTCCCAGCTTCTAGAGG - Intronic
990955288 5:61333255-61333277 GGGCTGTTCGCCGGTTTCGGGGG + Intronic
995408280 5:111826849-111826871 GAGCTTTTCCCCCATTTTAGTGG + Intronic
996047690 5:118893797-118893819 TGGCTGTTCCCGGATTCTAGAGG - Intronic
996330495 5:122323130-122323152 GCGCTGTTGCCCGAGTTCATGGG - Intronic
1007605432 6:43114508-43114530 TGGCTGTGCCCCCATTCCAGGGG - Intronic
1010618366 6:78041967-78041989 GGGGTCTTCCCCATTTTCAGGGG - Intergenic
1012658870 6:101860677-101860699 GGGCTGTTTTCTGTTTTCAGTGG + Intronic
1015471382 6:133610623-133610645 GGACAGTTCCCTGATGTCAGGGG + Intergenic
1022233360 7:28436777-28436799 GGGCTGGTCCCCTTTATCAGAGG - Intronic
1029466304 7:100727246-100727268 AGGGTGTTGCCAGATTTCAGAGG + Intergenic
1029929214 7:104352963-104352985 GGGTTGGTGCCTGATTTCAGTGG + Intronic
1031156491 7:118117301-118117323 GGCCAGCTCCCCGATTTCACTGG + Intergenic
1035604429 8:920332-920354 GGGCTATTCCCTGATAACAGGGG - Intergenic
1038654076 8:29432605-29432627 GGGCTGTGCTCCTATTTCAGAGG + Intergenic
1042710814 8:71715308-71715330 GGTCTGTTTCCAGATTGCAGAGG - Intergenic
1042964445 8:74335730-74335752 GGGCTGTTACTTGATTTCAGAGG - Intronic
1044913897 8:97091484-97091506 GGCCAGTTCCCAGATGTCAGAGG + Intronic
1046863197 8:119117615-119117637 GGCCTATTCCTAGATTTCAGAGG - Intergenic
1048484836 8:134837508-134837530 GGGTTGTTCCCCTAGTTCAAAGG + Intergenic
1049211510 8:141388610-141388632 CCTCTGTTCCCTGATTTCAGTGG - Intergenic
1049396881 8:142405060-142405082 GGGCTCATCCCAGATTTCGGAGG - Intergenic
1051302720 9:15670207-15670229 GGTGTGTTCCCCCATTTCAGTGG + Intronic
1052776544 9:32738758-32738780 GTGCTGATCCCCTTTTTCAGAGG - Intergenic
1057440695 9:95081092-95081114 GGGTAGATCCCTGATTTCAGTGG + Intronic
1061763289 9:132865361-132865383 AGGCTGTTCCCCGGTTTAACTGG - Intronic
1061936188 9:133858913-133858935 GGGCAGTTCCCCGACCTGAGAGG + Intronic
1190277224 X:48906596-48906618 GGCCTGTTCCCAGCCTTCAGGGG - Intronic
1193418018 X:81248367-81248389 CTGCTGTGCCACGATTTCAGCGG + Intronic
1194281704 X:91961884-91961906 GGGCTTTTCCCCCTTTTCATAGG - Intronic
1198438352 X:136638525-136638547 GGTTGGTTCCCCGATGTCAGGGG + Intergenic
1200599295 Y:5186537-5186559 GGGCTTTTCCCCCTTTTCACAGG - Intronic