ID: 1175424054

View in Genome Browser
Species Human (GRCh38)
Location 20:58853322-58853344
Sequence CGGGCTGTTCCCCGATTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424054_1175424057 -5 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424054_1175424069 23 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424054_1175424062 4 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424054_1175424070 24 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424054_1175424065 17 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424054_1175424060 2 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424054_1175424061 3 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424054_1175424056 -8 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424054 Original CRISPR CGGGCTGTTCCCCGATTTCA GGG (reversed) Exonic
904595944 1:31645309-31645331 CGGTCGGTTCCCCGTTGTCAGGG - Intergenic
907384156 1:54115066-54115088 CAGGCTGTTCCCAGAGTGCAAGG + Intergenic
1075739182 10:124683350-124683372 CAGGTTGTTCCCTGATATCATGG - Intronic
1076531526 10:131148173-131148195 CAGGCTATTCCCCCATCTCAGGG - Intronic
1080231118 11:30017960-30017982 TGGGCTGTTCCTCGAAGTCAGGG + Intergenic
1084943129 11:72625014-72625036 AGGGCTGTTGCCCCATGTCACGG + Intronic
1096589893 12:52651035-52651057 CTGGCTTTTCTCCTATTTCAAGG - Intronic
1115478850 14:33842053-33842075 TGGGCTGTTCCCAGATGGCATGG + Intergenic
1127852325 15:62924650-62924672 CAGGCTGTTTCCCGTTCTCAGGG + Intergenic
1129320266 15:74770863-74770885 TGGGCTGCTCCCTGATTTGAAGG - Intergenic
1130884767 15:88083712-88083734 TGGCCTGTTCCCCCATTTGAAGG + Intronic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG + Intronic
1134406246 16:13961464-13961486 CAGGCTGTTCGCCGGTTTCGAGG + Intergenic
1136573272 16:31109101-31109123 GGGGCTCTTCTCCGACTTCAGGG - Exonic
1145012547 17:19378132-19378154 CGGGCAGTTCCCCGAGCTCACGG + Intronic
1160947529 19:1650686-1650708 CGGGCTGTTCCTCCCTTTCCCGG - Intronic
1163105857 19:15122754-15122776 CGTGCTGTACCCCTACTTCATGG - Exonic
1165824418 19:38697726-38697748 AGGGCTGTTCCCCGAGGGCAAGG - Intronic
1168596442 19:57681715-57681737 GGGGCTTTTCCCAGATTTCTGGG - Intergenic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
938592328 2:132751596-132751618 CAGCCTGTTCTCCTATTTCAAGG + Intronic
946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1184659161 22:45957957-45957979 TGGGCTGTTGCCCGCATTCAGGG - Intronic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
956489687 3:69757618-69757640 CTGGCTCTTCCCCAAGTTCAGGG - Intronic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
969392752 4:6902017-6902039 CTGGCTGTTCTCAGATCTCATGG - Intergenic
977366747 4:96079255-96079277 CAGGCTGTTCCCCTGCTTCAGGG - Intergenic
985681240 5:1256989-1257011 AGAGCTGGGCCCCGATTTCACGG - Intronic
990955287 5:61333254-61333276 AGGGCTGTTCGCCGGTTTCGGGG + Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG + Intergenic
1007605433 6:43114509-43114531 CTGGCTGTGCCCCCATTCCAGGG - Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1025089808 7:56052331-56052353 CGGGCTTTTCCCAGATTTTAGGG - Intronic
1025901960 7:65751622-65751644 CGGGCTTTTCCCCGATCTTAGGG - Intergenic
1031444028 7:121828778-121828800 CAGGCAGTTTCCCTATTTCAGGG + Intergenic
1038654352 8:29435667-29435689 CTGCCTGTGCCCAGATTTCATGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1193016674 X:76741456-76741478 CCGGCTTTCCCCCGCTTTCATGG + Intergenic
1197569043 X:128127058-128127080 CGGGTTGTTCCCTGAGCTCAAGG + Intergenic