ID: 1175424055

View in Genome Browser
Species Human (GRCh38)
Location 20:58853323-58853345
Sequence TCGGGCTGTTCCCCGATTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424055_1175424070 23 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424055_1175424065 16 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424055_1175424069 22 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424055_1175424062 3 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424055_1175424057 -6 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424055_1175424061 2 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424055_1175424060 1 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424055_1175424056 -9 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424055 Original CRISPR TCGGGCTGTTCCCCGATTTC AGG (reversed) Exonic
904595945 1:31645310-31645332 TCGGTCGGTTCCCCGTTGTCAGG - Intergenic
904907190 1:33906575-33906597 TAGGGATATTCCCAGATTTCTGG + Intronic
908031994 1:60010706-60010728 TCTTGCTGTTCCCTGATCTCTGG - Intronic
912680623 1:111726827-111726849 TCTGGCTTCTCCCCGCTTTCTGG + Exonic
915459083 1:156059083-156059105 TCAGGCTGTTCTCCAACTTCTGG + Intergenic
916942838 1:169694195-169694217 TCAGCCTGGTCCCTGATTTCAGG - Intronic
1063278239 10:4595408-4595430 TCAGGCTGGTCTCCAATTTCTGG - Intergenic
1074095645 10:110309681-110309703 TGGGGCACTTCCCTGATTTCTGG - Intergenic
1084891413 11:72238792-72238814 TCGGGCTATTCCTTCATTTCCGG - Exonic
1100641198 12:96483934-96483956 TCAGGCTGTTCTCGAATTTCTGG + Intergenic
1121400601 14:93673794-93673816 TCAGCCTGTTCCCCCACTTCTGG - Intronic
1123030776 14:105450084-105450106 TCGGGCAGGTCCACCATTTCCGG - Exonic
1129483034 15:75843159-75843181 TCCGGCTCCTCCCCGACTTCTGG + Intergenic
1145097540 17:20043632-20043654 TTGGGCAGTTCCTTGATTTCTGG + Intronic
1156597187 18:38561002-38561024 TCGGGCTGTTACCGCATATCTGG - Intergenic
1161268506 19:3376094-3376116 TCAGGCTGTTCCCTGCTTCCTGG + Intronic
1168596443 19:57681716-57681738 AGGGGCTTTTCCCAGATTTCTGG - Intergenic
925341892 2:3143421-3143443 TGGGGCTGGTGCCCGACTTCTGG - Intergenic
928470715 2:31573091-31573113 ATGGCCTGTTCCCAGATTTCTGG - Intronic
938690948 2:133788556-133788578 TCAGGCAGTTCCCCTATCTCAGG + Intergenic
1173528155 20:43748589-43748611 TCAGGCTGGTCTCAGATTTCTGG + Intergenic
1175424055 20:58853323-58853345 TCGGGCTGTTCCCCGATTTCAGG - Exonic
1180053487 21:45344707-45344729 TCGGCCTCATCCTCGATTTCAGG + Intergenic
960356148 3:116655896-116655918 TTGGGCTGTTCACTTATTTCAGG - Intronic
990955286 5:61333253-61333275 GAGGGCTGTTCGCCGGTTTCGGG + Intronic
1003500673 6:6700442-6700464 TCAGGCTGTTCCCAGAGCTCCGG + Intergenic
1020673231 7:11146389-11146411 TCCAGCTGTTGCCCCATTTCTGG + Intronic
1025089809 7:56052332-56052354 ACGGGCTTTTCCCAGATTTTAGG - Intronic
1025901961 7:65751623-65751645 ACGGGCTTTTCCCCGATCTTAGG - Intergenic
1028183021 7:87747969-87747991 TTGCGCTCTTCCCCGAGTTCTGG + Intronic
1033619148 7:143046836-143046858 TCAAGCTCTTCCCCGACTTCAGG + Intergenic
1038435935 8:27536028-27536050 TCTGGCTGTTCCCAGGTCTCTGG - Intronic
1041102900 8:54414734-54414756 TCTGACTGGTCCTCGATTTCAGG - Intergenic
1061232036 9:129320758-129320780 ACGTTCTGTTCCCCGCTTTCGGG + Intergenic
1195857287 X:109344896-109344918 TTGGCCTGTTTCCTGATTTCAGG - Intergenic
1201460441 Y:14216648-14216670 TCAGGCTGTTCTCCAATTTTTGG + Intergenic