ID: 1175424056

View in Genome Browser
Species Human (GRCh38)
Location 20:58853337-58853359
Sequence ACAGCCCGAGCAACCACCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424052_1175424056 -6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424054_1175424056 -8 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424053_1175424056 -7 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424055_1175424056 -9 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424051_1175424056 -5 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424056 Original CRISPR ACAGCCCGAGCAACCACCTT TGG Exonic