ID: 1175424056

View in Genome Browser
Species Human (GRCh38)
Location 20:58853337-58853359
Sequence ACAGCCCGAGCAACCACCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424052_1175424056 -6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424054_1175424056 -8 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424055_1175424056 -9 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424053_1175424056 -7 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1175424051_1175424056 -5 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424056 Original CRISPR ACAGCCCGAGCAACCACCTT TGG Exonic
900422181 1:2560437-2560459 ACAGCCAGAGCCACCACCCCAGG + Intronic
902253518 1:15171823-15171845 AGAGCCCCAGAAACCACCTGTGG - Intronic
906694328 1:47814046-47814068 AGAGCCAGAGCCACCTCCTTTGG - Intronic
908278746 1:62506378-62506400 GCAGCTCAAGCAACCATCTTGGG + Intronic
910442287 1:87265330-87265352 AGAGCCTGGGCAACCACATTCGG - Intergenic
911185750 1:94903096-94903118 ACAGCCAAACCAACCACCTCTGG - Intronic
913228614 1:116722079-116722101 ACAGCCAGAGCACGCCCCTTTGG - Intergenic
922251910 1:223856904-223856926 ACGGAGCGAGCAGCCACCTTTGG - Intergenic
924149501 1:241114106-241114128 ACAGCCCCTGCAACCAGCCTGGG + Intronic
1063441970 10:6080019-6080041 ACAGACCAAGGAACCGCCTTGGG - Intergenic
1072996400 10:100248719-100248741 ACAGAGCAAGCAGCCACCTTTGG + Intronic
1074065129 10:110007413-110007435 ACAGCCCCAGCAGCCAGCGTGGG + Intronic
1078314451 11:10281298-10281320 GCAGCCCCAGCAGCCATCTTGGG - Intronic
1081507559 11:43734213-43734235 ACGGAGCGAGCAGCCACCTTTGG + Intronic
1084506757 11:69573196-69573218 ACAGCATGAGCAGGCACCTTGGG - Intergenic
1084798756 11:71527320-71527342 ACAGCCGGAGCCACAGCCTTCGG - Exonic
1091228474 11:133972454-133972476 ACAGCCCGAGCAGACACCCAAGG + Intergenic
1096005688 12:48169177-48169199 ACGGAGCGAGCAGCCACCTTAGG - Intronic
1097216556 12:57418387-57418409 GCAGCCTGCGCAACCACCGTTGG - Intronic
1101331145 12:103758831-103758853 ACAGCCCCACCAGCCACCTGAGG + Intronic
1102060666 12:109928507-109928529 ACACCCAGAGCAACCTCCTCAGG - Intronic
1113939686 13:114012043-114012065 GCGGCCCCAGCAACCACATTGGG + Intronic
1116720512 14:48489945-48489967 ACAGCCTGACCAACAGCCTTAGG - Intergenic
1117978596 14:61321339-61321361 CCAGCCCGAGCAAACACCTGAGG - Intronic
1128080669 15:64855162-64855184 TCAGCCCTAGCAGCCACCATAGG + Intronic
1137966070 16:52935283-52935305 ACAGAGCGAGCAGCCACCTTTGG + Intergenic
1139209891 16:65067009-65067031 ACAGCCCCTGCAACAGCCTTTGG - Intronic
1143982271 17:10880254-10880276 ACAGCACAAGGAGCCACCTTTGG + Intergenic
1145007002 17:19343801-19343823 TCACCCTGAGCCACCACCTTGGG + Exonic
1148670864 17:49409067-49409089 ACAGAGCGAGCCGCCACCTTTGG - Exonic
1149170049 17:53798865-53798887 ACATCACGAGAAACCTCCTTAGG - Intergenic
1152044122 17:77924727-77924749 CCTGCCCCAGCAGCCACCTTGGG - Intergenic
1158713267 18:59855729-59855751 ACATCCCCAGCAACCAATTTAGG + Intergenic
1161869853 19:6861793-6861815 ACAGCCCAGGTAGCCACCTTAGG - Intergenic
1163124263 19:15236311-15236333 ACAGGCAGAGCAGCCACCTGTGG + Exonic
927682162 2:25146819-25146841 ACGGCCCTAGGAACCACCGTGGG - Intronic
928938942 2:36707989-36708011 ACAACACCAGCAGCCACCTTAGG - Intronic
933837228 2:86255902-86255924 ACAACCCGAGCAACCATATTTGG + Intronic
934677669 2:96261074-96261096 ACAGCCCCAGGAAGCATCTTTGG - Intronic
944202189 2:197119522-197119544 ACAGGCCGAGCCACCACACTTGG + Intronic
944850826 2:203717316-203717338 GCAGACCAAGCAACCAGCTTTGG - Intronic
946225839 2:218263609-218263631 ACAGCCCCTGCAGGCACCTTTGG - Exonic
948948895 2:241236336-241236358 ACAGCCCCCGCACCCACCGTGGG + Intronic
1168954789 20:1827368-1827390 ACAGCCAGTGCAACGACCTGGGG + Intergenic
1174914647 20:54642204-54642226 ACAGCCTGACCAACCACATCGGG - Intronic
1175424056 20:58853337-58853359 ACAGCCCGAGCAACCACCTTTGG + Exonic
1177746556 21:25222090-25222112 ACAGCCCCAGAACCCTCCTTGGG - Intergenic
1182341011 22:29620753-29620775 CCAGCCTGAGCAACCAACGTAGG - Intronic
1183696967 22:39428947-39428969 CCAGGCCGAGCAAGCTCCTTGGG + Intronic
1185173065 22:49304669-49304691 CCACCCCGAGCAACCTCCCTGGG + Intergenic
954703384 3:52464799-52464821 ACAGCCTGAGCCACCACATCCGG + Intronic
956517047 3:70061115-70061137 ACTGCCAAAGCTACCACCTTTGG - Intergenic
958788692 3:98626645-98626667 ACAACCAAAACAACCACCTTAGG - Intergenic
962950849 3:140217163-140217185 ACAGCCAGAGCAAACTCCTAGGG - Intronic
963857672 3:150271987-150272009 AGAGCCCGGGCCACCAACTTTGG - Intergenic
964993376 3:162844051-162844073 ACAGCAGGGGCAACCCCCTTGGG - Intergenic
968581317 4:1396645-1396667 GGAGCCCCAGCAGCCACCTTGGG - Intergenic
970095509 4:12459421-12459443 ACAGCAACAGCAACCCCCTTTGG + Intergenic
972469323 4:39388682-39388704 ACAGGCCGAGCCACCACATCTGG - Intergenic
972472682 4:39422129-39422151 ACAGCCTGTTCAATCACCTTCGG + Intronic
975060043 4:69985944-69985966 ACAGCCAGAGCAAGCGCTTTAGG + Intergenic
985664473 5:1174850-1174872 GGAGCCTGAGCAGCCACCTTGGG - Intergenic
989754378 5:44935510-44935532 ACAGCCCTAGTATCCTCCTTGGG - Intergenic
997698618 5:135880767-135880789 ACAGCCTGAGCAAAGACCTAGGG - Intronic
1000856194 5:166401295-166401317 AGAGCCCGATCACCCACCTCTGG + Intergenic
1007885006 6:45217612-45217634 ACAGCGTGAGCCACCACATTCGG - Intronic
1017630312 6:156390699-156390721 ACAGCTTGAGCCACCCCCTTGGG + Intergenic
1028442508 7:90880291-90880313 ACAGCCCAACCTACCACCTGTGG + Intronic
1029032389 7:97482495-97482517 ACAGTGCTAGGAACCACCTTAGG - Intergenic
1031799923 7:126230078-126230100 TCAAACCGACCAACCACCTTTGG - Intergenic
1035698659 8:1621261-1621283 CCAGCCGGACCAACCACCTCCGG - Intronic
1041166318 8:55096196-55096218 ACAGCACATGCAACCACCCTGGG - Intergenic
1044447972 8:92300524-92300546 ACACACCAAGCAACCTCCTTCGG + Intergenic
1061016281 9:127982514-127982536 ACAGCCAGAGCAAGCTTCTTAGG - Intergenic
1201911845 Y:19140618-19140640 ACAGCAGCAGCAACCAGCTTGGG + Intergenic