ID: 1175424057

View in Genome Browser
Species Human (GRCh38)
Location 20:58853340-58853362
Sequence GCCCGAGCAACCACCTTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424052_1175424057 -3 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424054_1175424057 -5 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424051_1175424057 -2 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424053_1175424057 -4 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1175424055_1175424057 -6 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424057 Original CRISPR GCCCGAGCAACCACCTTTGG AGG Exonic
906298249 1:44662320-44662342 GGCCGAGCCAGCACCTGTGGAGG - Intronic
915041313 1:152970416-152970438 GTTTGAGCAAACACCTTTGGTGG + Intergenic
915475949 1:156152974-156152996 GGGTGAGCAGCCACCTTTGGGGG + Intronic
924051304 1:240082066-240082088 GCCCGAGAACCCACTTTTGGGGG - Intronic
1084374632 11:68767945-68767967 GCCCTCAAAACCACCTTTGGAGG + Intronic
1084645605 11:70455703-70455725 GCCCTCAAAACCACCTTTGGAGG - Intergenic
1085410571 11:76288150-76288172 GCCAGAGAAACCCCCTCTGGAGG + Intergenic
1098523568 12:71461039-71461061 GCCACAGCATCCACATTTGGAGG + Intronic
1102009282 12:109608043-109608065 GACCCAGCAAACCCCTTTGGAGG - Intergenic
1105606766 13:21932490-21932512 GCCAGAGCAACTACCTTCGAGGG - Intergenic
1107655639 13:42589980-42590002 GCCCGCCCACCCACCTGTGGGGG + Intronic
1115895233 14:38078905-38078927 CCAAGAGCATCCACCTTTGGGGG + Intergenic
1123001047 14:105294238-105294260 GGCCCAGCAACCAACTGTGGTGG - Intronic
1128213414 15:65917591-65917613 GCCCGGGCAGCCACCTCAGGAGG - Intronic
1129180251 15:73869729-73869751 GTCCGAGCTACCTGCTTTGGTGG + Intergenic
1139682999 16:68580293-68580315 GCACCAGCGAGCACCTTTGGGGG - Intergenic
1139797464 16:69495307-69495329 GTCCTTCCAACCACCTTTGGGGG - Intergenic
1141841125 16:86574786-86574808 CCCAGAGCACCCACTTTTGGAGG + Intergenic
1156640183 18:39085670-39085692 GCGTGAGCCACCGCCTTTGGTGG + Intergenic
1165474379 19:36021702-36021724 GCATGAGCCACCACATTTGGCGG + Intronic
1168681318 19:58318069-58318091 CACCCAGCAAACACCTTTGGTGG - Intergenic
929569770 2:43014842-43014864 GCTAGAGCAACCACCTTGGAGGG + Intergenic
937271747 2:120657232-120657254 GCCTGAGAGCCCACCTTTGGGGG - Intergenic
948931775 2:241136791-241136813 TCCCCAGCAACCACCGTCGGAGG - Intronic
1170840643 20:19922333-19922355 GCCTGAACCACCAGCTTTGGGGG + Intronic
1173576546 20:44115928-44115950 GCCCGAGCCCCCACCCTTTGAGG - Exonic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1178055306 21:28791958-28791980 GCCAAAGCCACCATCTTTGGTGG - Intergenic
1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG + Intronic
1180160446 21:45996776-45996798 GCCCCAGCTCCCACCTTTGAGGG - Intronic
955339761 3:58116348-58116370 GCCCAAGCAGCCACCTTTCTGGG - Intronic
961518369 3:127452605-127452627 CCCTGAGCAACCATCTGTGGAGG + Intergenic
962370312 3:134815987-134816009 GCCCCAGCATTTACCTTTGGTGG - Intronic
976287826 4:83387058-83387080 GCCAGAACCACCACCATTGGTGG + Intergenic
977708132 4:100093935-100093957 GCAAGAGCAAGCAACTTTGGGGG + Intergenic
985994955 5:3592649-3592671 GCCTCAGCCACCCCCTTTGGAGG + Intergenic
998113937 5:139522438-139522460 GCCTGAGCTACCTCCTTTGGAGG - Intergenic
1009815248 6:68725029-68725051 GCACCACCAACCACATTTGGGGG + Intronic
1026421534 7:70242171-70242193 GCACGGGCAACCACCTGAGGTGG - Intronic
1034165255 7:149020569-149020591 GCCTGAGCAACAGCCTTTGAGGG + Intronic
1041028991 8:53717105-53717127 CGCCAAGAAACCACCTTTGGGGG + Intronic
1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG + Intronic
1059280061 9:113125245-113125267 GCCACTACAACCACCTTTGGTGG - Intergenic
1194800233 X:98264102-98264124 CCCCGAGCAACCACCATGGCTGG + Intergenic