ID: 1175424060

View in Genome Browser
Species Human (GRCh38)
Location 20:58853347-58853369
Sequence CAACCACCTTTGGAGGCCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424054_1175424060 2 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424053_1175424060 3 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424052_1175424060 4 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424055_1175424060 1 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170
1175424051_1175424060 5 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424060 Original CRISPR CAACCACCTTTGGAGGCCCC AGG Exonic
900369217 1:2323978-2324000 CACCTACCTCTGGGGGCCCCGGG + Intronic
901260934 1:7870154-7870176 CAGCCACCTTTGAAGGTACCGGG - Intergenic
902172838 1:14627036-14627058 CAGCCACTGTTGGAGGCCCTGGG + Intronic
903967681 1:27100498-27100520 CAGCCACCTTTGCAGGATCCCGG + Exonic
904872213 1:33625814-33625836 CATCCACTTTTGTAGGGCCCAGG - Intronic
905440323 1:37992436-37992458 CACCCACCTGTGGGGGCCACAGG - Intergenic
905597535 1:39220923-39220945 CAGCCACCTTTGGATGCCTATGG - Intronic
906035178 1:42746444-42746466 CAGCGGCCTGTGGAGGCCCCTGG + Exonic
906368194 1:45228848-45228870 CAATCACCTTTGGTTGCCACTGG - Intronic
907915583 1:58865871-58865893 CAACCTCCTTGGTAGGCCCTGGG - Intergenic
912124561 1:106518729-106518751 GAACCACTTTGGGAGGCCCAAGG + Intergenic
915839522 1:159203229-159203251 ACACCACCTTTTGAGGCACCAGG - Intronic
918316863 1:183329733-183329755 CAACCATCTCTGCAGGCTCCTGG - Intronic
920703056 1:208232160-208232182 CCACCACCTGTGCAAGCCCCTGG - Intronic
921390146 1:214607722-214607744 CAAACACCAGTGAAGGCCCCAGG + Intronic
922161242 1:223080498-223080520 CAACCAGGTTTGAAGGCCACAGG + Intergenic
924614648 1:245602726-245602748 CAAACATCTTTGGAGGAACCTGG - Exonic
924887434 1:248234453-248234475 CAACCCCCTTAACAGGCCCCAGG + Intergenic
1065076709 10:22087315-22087337 CAAGCACATCTGCAGGCCCCAGG - Intergenic
1065726383 10:28671288-28671310 GAACCACCTTGCGAGGCCCAGGG + Intergenic
1066541118 10:36447791-36447813 CCACCACTTTGGGAGGCCCAGGG + Intergenic
1066543193 10:36471244-36471266 CGACCACCTTGTGAGGCCCCGGG - Intergenic
1066548997 10:36534558-36534580 CAAGCACACTTGGAGGCCACTGG - Intergenic
1069655260 10:70083141-70083163 CAGCCAGCTCTGGAGACCCCGGG - Intronic
1070036047 10:72725522-72725544 CCAACACTTTGGGAGGCCCCAGG - Intronic
1070572431 10:77650273-77650295 CCAGGACCTTTGGAGGCCCTGGG + Intergenic
1070808790 10:79286861-79286883 GAACCCCCATGGGAGGCCCCAGG - Intronic
1074377781 10:112952711-112952733 CACCCAACTTTGGGGGCCCCAGG + Intronic
1075125366 10:119694883-119694905 CAAGCACCTGTGGTGGCACCTGG - Intergenic
1076100306 10:127772365-127772387 CCACCACCCATGGAGGCCACAGG + Intergenic
1076203063 10:128573216-128573238 CCACCATCCTGGGAGGCCCCAGG - Intergenic
1076441686 10:130484913-130484935 CTCCCAGCTTTGGTGGCCCCTGG + Intergenic
1076822307 10:132945557-132945579 CAGCCAACTTTGGGGTCCCCAGG - Intergenic
1077380665 11:2235551-2235573 CACCCACCCTGGGAGGGCCCAGG + Intergenic
1078102594 11:8338552-8338574 GAACCACCTCTGGGGACCCCAGG + Intergenic
1081445928 11:43131537-43131559 CAGCCACCTTTGGAGCCACAGGG - Intergenic
1081806705 11:45894824-45894846 CATCCACCTTTGGAGCAGCCAGG + Intronic
1083420024 11:62547156-62547178 CAGCCACCTTCAGAGCCCCCAGG - Intronic
1083777869 11:64902999-64903021 CAGCCACCTTTGTAGGTCCCCGG - Intronic
1085312269 11:75523882-75523904 AAACCACCTTGGAAAGCCCCTGG - Intronic
1085627337 11:78083467-78083489 CAATCACCTTGGAAGCCCCCTGG + Intergenic
1091348350 11:134871539-134871561 CAGCCACATTTGGGGTCCCCAGG + Intergenic
1091760237 12:3082504-3082526 CATCAACCTTGGGAGGCCCTGGG + Intronic
1097068217 12:56336212-56336234 CCAGCACTTTTGGAGGCCGCAGG + Intronic
1098453348 12:70645081-70645103 CAGCCACCTTTGTAGAACCCTGG - Intronic
1098882017 12:75926649-75926671 CAACCTCCTGGGGAGGTCCCAGG - Intergenic
1100325219 12:93533809-93533831 CATCCCCCTTTGCAGACCCCTGG - Intergenic
1102981567 12:117245666-117245688 CCAGCACTTTGGGAGGCCCCGGG + Intronic
1106052524 13:26204996-26205018 CAAGCCGCTTTGGAGGGCCCAGG - Intronic
1106591948 13:31105590-31105612 CAACCCCCTCTGGTGGCCCATGG + Intergenic
1109164721 13:59019770-59019792 CAAACACTTTCGGAGGCCCAGGG - Intergenic
1112294762 13:98177018-98177040 CTGCCAGCTGTGGAGGCCCCGGG + Exonic
1113709357 13:112453588-112453610 CATGCACCCTTGGAGGCCCTCGG - Intergenic
1113946932 13:114049749-114049771 AGAACACCCTTGGAGGCCCCTGG + Intronic
1114454767 14:22847381-22847403 CCACCACCTTTGGTGGCCCAAGG - Exonic
1117590483 14:57263218-57263240 CCAGCACCTTGGGAGGCCCTAGG + Intronic
1118817417 14:69323275-69323297 CAAACCCCTTTAGAGGCTCCTGG + Intronic
1119658888 14:76436693-76436715 CAACCACCAGTGGAGTCCCCAGG - Intronic
1121739249 14:96240029-96240051 CAACTCCCTTGGGAGGGCCCCGG + Intronic
1122857618 14:104567421-104567443 CAAGCACCTAAGGAGGCCCCTGG + Intronic
1130197445 15:81793893-81793915 CAATCACCTTTGGATAACCCTGG - Intergenic
1130577824 15:85107898-85107920 AAACCACCTTTGGAAACACCAGG + Intronic
1133580341 16:7138637-7138659 CCTTCACCTTTGTAGGCCCCAGG - Intronic
1134366737 16:13585793-13585815 CTCCCACTTTTGGAGCCCCCAGG + Intergenic
1135622854 16:23970724-23970746 CAAACACCTTTTGAGCCCCAGGG - Intronic
1136509144 16:30725015-30725037 CTACCTCGTTTGGTGGCCCCCGG + Exonic
1137070613 16:35901420-35901442 CTACAACATTTGGAGGCTCCAGG - Intergenic
1137070700 16:35902001-35902023 TTACAACATTTGGAGGCCCCAGG - Intergenic
1140698734 16:77561395-77561417 CAACGACCTTGGGAGGTCTCAGG + Intergenic
1141979547 16:87541401-87541423 CGCCCACCTTCAGAGGCCCCCGG + Intergenic
1142440899 16:90096915-90096937 CAACCACATCTGCAGCCCCCAGG - Intergenic
1144933094 17:18875881-18875903 CCACCACTTTGGGAGGCCCCAGG + Intronic
1144957132 17:19024397-19024419 CCACCACCTGAGGTGGCCCCGGG - Intronic
1145232013 17:21180014-21180036 CCAGCACTTTGGGAGGCCCCAGG - Intronic
1145836483 17:27957783-27957805 CAACCACCTTTGAAGGCCAAGGG - Intergenic
1147181548 17:38689497-38689519 CCAGCACTTTTGGAGGCCCAGGG - Intergenic
1147584017 17:41642636-41642658 CAGGCACCTTGGGAGGCCCAGGG + Intergenic
1148240967 17:45999067-45999089 CATGCACCTCTGGGGGCCCCTGG + Intronic
1150072594 17:62164415-62164437 AAACAACCTTTGGAGGGGCCGGG + Intergenic
1150489404 17:65563931-65563953 CCACCACCTTTGGCCACCCCAGG + Intronic
1151696082 17:75718459-75718481 CAGCCTACTTTGGAGACCCCTGG + Intergenic
1152262124 17:79272932-79272954 CCACCACCCTCGGAGGCTCCTGG - Intronic
1153705788 18:7744296-7744318 CCACCACCTTTCAAGGCCCTAGG - Intronic
1157665720 18:49485303-49485325 CAAGCACCTTGGGAGGCCGAGGG + Intronic
1158700696 18:59743286-59743308 CAACCTCCTTAGGAGACCTCTGG + Intergenic
1162548513 19:11345533-11345555 CACCCACATTTGCATGCCCCAGG + Exonic
1163399965 19:17086195-17086217 TAACCACATTTGCAGGGCCCTGG + Intronic
1163424101 19:17231603-17231625 AATCCACTTTTGGAGGCCTCAGG + Intergenic
1164667568 19:30051664-30051686 CAGCCAGCTTTGGAGTCCCTGGG - Intergenic
1168166984 19:54555336-54555358 CAACCACCTCAGGAAGCCCAGGG - Intergenic
925129093 2:1481799-1481821 CAGCCAACATTGGAGGCCACTGG - Intronic
925747082 2:7052461-7052483 GAACCATCCTTGGAGGCCACAGG - Intronic
926622205 2:15057077-15057099 CCACCACTTTGGGAGGCCCAGGG - Intergenic
927111112 2:19864344-19864366 CCAGCACTTTGGGAGGCCCCAGG - Intergenic
929802707 2:45117810-45117832 CAGCCCACTTTGGAGGCCTCTGG + Intergenic
929845291 2:45519516-45519538 TAATCACCTTTGGAGGACACAGG - Intronic
931472852 2:62556885-62556907 GAACCTCCTTTGGAGGCAGCTGG - Intergenic
931881723 2:66576441-66576463 CAACCTCCTTCGCAGACCCCTGG - Intergenic
935264337 2:101381791-101381813 CAAACACCTGTGCAGCCCCCTGG - Intronic
939177345 2:138764299-138764321 CAGCCAGGTTTGGAGACCCCTGG - Intronic
939731439 2:145789369-145789391 CAACCACCTTTGGAAGCTGGAGG - Intergenic
944430547 2:199628979-199629001 GAACCACCTTTGCAGGTCCCAGG - Intergenic
948908400 2:240990955-240990977 CCCCCACCTGTGGAGGCCTCAGG - Intronic
948917945 2:241047676-241047698 CAGAAACGTTTGGAGGCCCCTGG + Intronic
1169524535 20:6409195-6409217 CAACCACCTTGGGTGGACTCAGG - Intergenic
1170430566 20:16272888-16272910 CACCCACTTTGGGAGGTCCCAGG + Intronic
1173306156 20:41852096-41852118 CAGCCACAATTGGGGGCCCCAGG + Intergenic
1173568180 20:44056537-44056559 CAACCACCTTTGCTTGCCTCTGG - Intronic
1175424060 20:58853347-58853369 CAACCACCTTTGGAGGCCCCAGG + Exonic
1175750033 20:61489843-61489865 GAAGTACTTTTGGAGGCCCCTGG - Intronic
1175906605 20:62382958-62382980 CCACCTCCTCTGCAGGCCCCTGG + Intergenic
1177755035 21:25335768-25335790 CTACCACCTTTGCTAGCCCCAGG + Intergenic
1179640842 21:42746389-42746411 CTGCCACCTCTGAAGGCCCCAGG + Intronic
1181955018 22:26582060-26582082 CAAACACCATCAGAGGCCCCTGG + Intronic
1181988191 22:26816432-26816454 CCACCCACTTGGGAGGCCCCTGG - Intergenic
1183506843 22:38214141-38214163 AAAGCACCTTTGAATGCCCCAGG - Intronic
1183848915 22:40566579-40566601 CAAGCACTTTGGGAGGCCCAAGG + Intronic
1184985242 22:48128116-48128138 CCAGCACGTTTGGAGGCCTCAGG + Intergenic
1185095403 22:48803603-48803625 CTCCCACCTGAGGAGGCCCCTGG - Intronic
1185136800 22:49077964-49077986 CAGCCACGTTTGGAGGCCCCAGG + Intergenic
949156640 3:835124-835146 GAAACACCTTTTGAGGCCTCTGG + Intergenic
949877428 3:8635345-8635367 TTCCCACCTTTGGAGGCCCCAGG - Exonic
949993693 3:9600376-9600398 CCAACACTTTGGGAGGCCCCAGG - Intergenic
951798284 3:26566614-26566636 CCTGCACCTTTGGAGGCCCCAGG - Intergenic
951853222 3:27166708-27166730 CTACCACTTTGGGAGGCCCAGGG + Intronic
952986849 3:38793436-38793458 CCAACTCCTCTGGAGGCCCCAGG + Intronic
954431335 3:50472406-50472428 CAGCCATGTTTGGAGGCCACAGG - Intronic
967106735 3:186260590-186260612 CAAACACCTCTGGAGCCCACTGG + Intronic
969238724 4:5886224-5886246 AAACCACCTTTAGAGGCTGCTGG + Intronic
969488741 4:7486685-7486707 GATCCTCCTTTGGAGGCTCCAGG - Intronic
976652401 4:87450112-87450134 CCAGCACTTTGGGAGGCCCCGGG - Intronic
977731912 4:100363834-100363856 CAGCCACCTATTTAGGCCCCTGG + Intergenic
978955590 4:114608696-114608718 CATCCACCTATAGAAGCCCCAGG - Intronic
981050203 4:140302081-140302103 CCAGCACCTTGGGAGGCCCAGGG - Intronic
981732357 4:147912895-147912917 CCACCACTTTGGGAGGCCCAGGG - Intronic
989359675 5:40586384-40586406 CACACATCTTTGGTGGCCCCTGG + Intergenic
990466792 5:56078494-56078516 CAACAACCTCAGGAAGCCCCAGG + Intergenic
997905833 5:137816044-137816066 AAAGCATCTTTGGAGACCCCAGG - Intergenic
997978221 5:138452886-138452908 CCATCACCTTTGGTGGCTCCTGG - Intergenic
1002449489 5:179310754-179310776 CACCCACCTTTGAGGGACCCTGG - Intronic
1004676083 6:17843793-17843815 CCACCACTTTTGGAGGCCGAGGG + Intronic
1005043549 6:21620712-21620734 CCTGCACCTTTGGGGGCCCCAGG - Intergenic
1006075770 6:31531303-31531325 CATCCACCGTGGGATGCCCCAGG - Exonic
1009831158 6:68937556-68937578 CATCCCCTTTTGGAGGTCCCTGG - Intronic
1013803387 6:113971155-113971177 AAACCACCTCAGGAGGCCGCAGG + Exonic
1015756399 6:136610857-136610879 CCAACACTTTTGGAGGCCACAGG + Intronic
1017735627 6:157360331-157360353 CAGCCACCTTCTGAGGCCCTGGG + Intergenic
1019079489 6:169420552-169420574 CACTCACCTTCGGAGGCCCTCGG - Intergenic
1019306673 7:338734-338756 CAGGCACCTGTGGAGGCCCACGG - Intergenic
1019985596 7:4653081-4653103 CATCCACCTTTGCTGGCCCTTGG - Intergenic
1020116728 7:5480294-5480316 CAGCCCCCTTTGGAAGCCACTGG + Intronic
1020957118 7:14754075-14754097 GAACCACCTTTTGAGGCCTATGG - Intronic
1021604540 7:22396953-22396975 CATACACCTTTGCAGGCCTCTGG + Intergenic
1023585663 7:41727162-41727184 CAACCAGCTGTGGAGCCCTCAGG + Intergenic
1026190243 7:68119082-68119104 AAACCACCTTTGTAAGACCCAGG + Intergenic
1028925754 7:96355402-96355424 CCAGCACCTTTGGAGGCCAAGGG + Intergenic
1032997538 7:137464500-137464522 CCACCACCTTTGGGGCTCCCAGG + Intronic
1034273606 7:149814732-149814754 CATCCGCATTAGGAGGCCCCAGG - Intergenic
1037917423 8:22781206-22781228 CCACCACGTTTGGATGCCCTTGG + Intronic
1038545580 8:28423709-28423731 CCACCACTTTTGGAGGCCGAGGG + Intronic
1038726540 8:30087149-30087171 CCAGCACTTTTGGAGGCCCGAGG + Intergenic
1039343867 8:36682453-36682475 CCACCCCCTTTGCAGGCCTCAGG + Intergenic
1039397947 8:37243509-37243531 CACCTGCCTTTGGAGGCCCTGGG - Intergenic
1040056684 8:43064562-43064584 CAAACACTTTAGGAGGCCGCGGG - Intronic
1040100381 8:43495680-43495702 CAATGACATTTGGAGGCCCTAGG - Intergenic
1040323318 8:46329200-46329222 CCACCACCTGTGTAGGCCCTTGG + Intergenic
1040973877 8:53169000-53169022 CTAACACTTTGGGAGGCCCCAGG + Intergenic
1042135822 8:65632187-65632209 CAAGCACTTTGGGAGGCCCAGGG + Intronic
1044199288 8:89414609-89414631 CAACAACCTTTGGAGGCAGTGGG - Intergenic
1045358247 8:101408517-101408539 CCAGCACTTTGGGAGGCCCCAGG - Intergenic
1045509880 8:102806263-102806285 GAACCACCTTTGGACACCCTGGG - Intergenic
1046641311 8:116734808-116734830 CTAGCACTTTTGGAGGCCCCGGG - Intronic
1049059371 8:140264288-140264310 GAAGCACCTTGGGAGGCCACAGG - Intronic
1059495583 9:114706474-114706496 CAACTATCTTTGTAGGCCCTTGG + Intergenic
1060917643 9:127400589-127400611 CACCCACCTCTGGAGCCCTCTGG - Intronic
1062001204 9:134216623-134216645 CAACGACCTTTGAAGGCATCTGG - Intergenic
1062466819 9:136685270-136685292 CAAGCACCATCAGAGGCCCCAGG + Intronic
1185574859 X:1163348-1163370 CCACCACCTTGGGAGGCCAGAGG + Intergenic
1186453225 X:9690559-9690581 CAGCCACATTCTGAGGCCCCTGG + Intronic
1188491172 X:30740241-30740263 CAACCATCTCTGTAGTCCCCAGG - Intergenic
1189224602 X:39402324-39402346 CACCCACCTTAGCAGGCTCCAGG - Intergenic
1190406523 X:50093492-50093514 CAAGCACCTTTGGTGTCACCAGG - Exonic
1192189129 X:68980040-68980062 CACCCACCTTCAGAGGTCCCTGG - Intergenic
1200167919 X:154050164-154050186 CAACCACTGTTTGATGCCCCTGG - Intronic