ID: 1175424061

View in Genome Browser
Species Human (GRCh38)
Location 20:58853348-58853370
Sequence AACCACCTTTGGAGGCCCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424055_1175424061 2 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424053_1175424061 4 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424052_1175424061 5 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424054_1175424061 3 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134
1175424051_1175424061 6 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424061 Original CRISPR AACCACCTTTGGAGGCCCCA GGG Exonic
900148471 1:1168248-1168270 GGCCACCTGTGGAGGCACCAAGG - Intergenic
903100566 1:21024994-21025016 TGCCACCTTTGGAGGCTCCCTGG - Intronic
904800812 1:33092028-33092050 AACCACCTTTGGGGCCCCATAGG + Exonic
905388027 1:37617695-37617717 AACCATCTTTTGAGGCTTCATGG + Intronic
905440322 1:37992435-37992457 ACCCACCTGTGGGGGCCACAGGG - Intergenic
908097473 1:60754127-60754149 TACAACCTATGGAGGCACCATGG - Intergenic
915062266 1:153195908-153195930 CACCACCTATGGAGGCCCAGTGG - Intergenic
915087480 1:153398197-153398219 AGACACCCTTGCAGGCCCCAAGG + Intergenic
916536623 1:165709552-165709574 AAGCACCTCTGGAGGCACGAGGG - Intergenic
918543769 1:185659599-185659621 AGCCACCTTGGCTGGCCCCAAGG + Intergenic
924464130 1:244284916-244284938 AGGCGCCTTTGAAGGCCCCAGGG - Intergenic
924887435 1:248234454-248234476 AACCCCCTTAACAGGCCCCAGGG + Intergenic
1063208234 10:3855023-3855045 AACCAGCCTTGGAGGCCACATGG - Intergenic
1065047088 10:21754376-21754398 AAGCACCTCTGGACCCCCCACGG + Intergenic
1066543192 10:36471243-36471265 GACCACCTTGTGAGGCCCCGGGG - Intergenic
1069032690 10:63614543-63614565 AACCACCCTTAGAGACCACATGG - Intronic
1070333951 10:75438218-75438240 AATCAGCTTTGGGGGCTCCAAGG - Intronic
1070808789 10:79286860-79286882 AACCCCCATGGGAGGCCCCAGGG - Intronic
1072691098 10:97572766-97572788 AACCGCCTCTGCAGGCCACAGGG - Exonic
1072798163 10:98372486-98372508 AACCTTCCTTGGAGGACCCATGG + Intergenic
1073727048 10:106245000-106245022 ACCCAGCTTTGCAGGTCCCATGG + Intergenic
1074377782 10:112952712-112952734 ACCCAACTTTGGGGGCCCCAGGG + Intronic
1075802691 10:125162221-125162243 TCCCGCCTTTGGAGGCCGCAGGG + Intergenic
1076052313 10:127345696-127345718 AGACACCTGTGCAGGCCCCAAGG - Intronic
1076100307 10:127772366-127772388 CACCACCCATGGAGGCCACAGGG + Intergenic
1076203062 10:128573215-128573237 CACCATCCTGGGAGGCCCCAGGG - Intergenic
1078102595 11:8338553-8338575 AACCACCTCTGGGGACCCCAGGG + Intergenic
1081806706 11:45894825-45894847 ATCCACCTTTGGAGCAGCCAGGG + Intronic
1081882786 11:46468287-46468309 AAGCACCTTAGGAGGTGCCAAGG + Intronic
1084019741 11:66410352-66410374 AAGCACCTTTCAAGGTCCCAGGG - Intergenic
1084712440 11:70852383-70852405 AACACCCTTTGCAGGCCCCGTGG - Intronic
1096313145 12:50539710-50539732 AAACACCTCTGAAGGCCCCGTGG + Intronic
1096780219 12:53987340-53987362 GACCACCTTTGCAGACCCAAGGG - Intronic
1097143507 12:56923756-56923778 TACCACCTTTTGTGACCCCACGG + Exonic
1097178287 12:57156296-57156318 AGCCAGCTTTGGAGGGGCCATGG - Intronic
1097271873 12:57780464-57780486 CAACACCTGTGCAGGCCCCATGG + Exonic
1102399375 12:112615341-112615363 AACAATCACTGGAGGCCCCAAGG - Intronic
1105786603 13:23756403-23756425 CAGCACTTTGGGAGGCCCCAAGG - Intronic
1106034752 13:26033567-26033589 AACCACATGGGGAGGCCACAGGG - Intergenic
1110956955 13:81564836-81564858 AAATACCTTTGGAGGTACCATGG + Intergenic
1111648193 13:91058163-91058185 AGCCACCCTTGGATGCCCCATGG - Intergenic
1113124067 13:106957185-106957207 AAACACCTGTGGAGAGCCCAGGG - Intergenic
1113483615 13:110639132-110639154 AAACCCTTTTGGAGGCACCATGG + Exonic
1119718085 14:76872933-76872955 CTCCACCTTTGGAGGCTCCCAGG - Intergenic
1120400756 14:84028309-84028331 ATCCTCCTTTGGAAGCCTCAGGG + Intergenic
1120824746 14:88945130-88945152 AACCACCCTTGGAGGGGCCCTGG + Intergenic
1120907399 14:89632545-89632567 CACCACCTGTGAAGGCCCAATGG - Intronic
1121832723 14:97065951-97065973 CAGCCCCTTTGTAGGCCCCATGG - Intergenic
1122857619 14:104567422-104567444 AAGCACCTAAGGAGGCCCCTGGG + Intronic
1124608449 15:31190844-31190866 CAGCACTTTGGGAGGCCCCAAGG + Intergenic
1125851942 15:42912456-42912478 CAGCACTTTGGGAGGCCCCAAGG + Intronic
1128154607 15:65384803-65384825 CTCAACCTTTGGAGGCTCCAGGG + Intronic
1128452052 15:67811419-67811441 AACCACCCTGTGGGGCCCCAGGG - Intergenic
1129326301 15:74801905-74801927 GCCCACCTCTGTAGGCCCCAGGG - Intronic
1130577825 15:85107899-85107921 AACCACCTTTGGAAACACCAGGG + Intronic
1131220738 15:90581988-90582010 AGGCACCCTTGGAGGCCACAAGG - Intronic
1132461895 16:59577-59599 ACCCACCTTTGTTGGCCCCAAGG + Intronic
1134366738 16:13585794-13585816 TCCCACTTTTGGAGCCCCCAGGG + Intergenic
1137070612 16:35901419-35901441 TACAACATTTGGAGGCTCCAGGG - Intergenic
1137070699 16:35902000-35902022 TACAACATTTGGAGGCCCCAGGG - Intergenic
1138534830 16:57654237-57654259 AACCTTCTCGGGAGGCCCCAGGG - Intronic
1138537425 16:57667371-57667393 GGCCAACTCTGGAGGCCCCACGG - Intergenic
1139140940 16:64261434-64261456 CACTACCTGTGGAGGCCCCTTGG + Intergenic
1139753137 16:69121233-69121255 CACCACCATTTGAGGCCCAAAGG + Intronic
1139935155 16:70565148-70565170 ATCCATCTTTGGAGCTCCCAAGG + Exonic
1143992011 17:10973717-10973739 AGACACGTTTGGAAGCCCCAAGG + Intergenic
1145836482 17:27957782-27957804 AACCACCTTTGAAGGCCAAGGGG - Intergenic
1146058906 17:29594284-29594306 GACCCTCTTGGGAGGCCCCAAGG + Intronic
1146624909 17:34427881-34427903 TATTCCCTTTGGAGGCCCCAAGG + Intergenic
1152229054 17:79105653-79105675 AAGCACCTCTGGCAGCCCCAGGG - Intronic
1155559298 18:27058615-27058637 AACCACACATGGAGGCCACATGG + Intronic
1155648744 18:28114617-28114639 AACCACCTTTGACTGCTCCATGG - Intronic
1158140142 18:54246845-54246867 CAGCACCTTGGGAGGCCCCAAGG + Intergenic
1160492749 18:79351788-79351810 CACCACCTTTGCGGCCCCCATGG - Intronic
1161505309 19:4640452-4640474 GAACGCCTTGGGAGGCCCCAGGG + Intronic
1164721842 19:30438255-30438277 CCCCACTTTTGGAGTCCCCAGGG + Intronic
1165362213 19:35343945-35343967 AAGCACTTTGGGAGGCCACAAGG + Intronic
1167782065 19:51605124-51605146 ATCCCCCTTTGGGGGTCCCATGG + Intergenic
931472851 2:62556884-62556906 AACCTCCTTTGGAGGCAGCTGGG - Intergenic
932748725 2:74357055-74357077 AACCATCTTTTGAGCCCCAAAGG - Intronic
939731438 2:145789368-145789390 AACCACCTTTGGAAGCTGGAGGG - Intergenic
945435221 2:209810057-209810079 CACCGCCTTCGAAGGCCCCATGG - Intronic
946233534 2:218307687-218307709 AGCCTCCCTTGGATGCCCCACGG - Intronic
1169300577 20:4438822-4438844 GACCATCCTTGGATGCCCCATGG - Intergenic
1170573348 20:17645130-17645152 GACCACCCTTCCAGGCCCCACGG + Intronic
1171389840 20:24794381-24794403 AACAGCCTTTGGTGGCCTCAGGG - Intergenic
1172757935 20:37300271-37300293 AAGCAAGTGTGGAGGCCCCAGGG - Intronic
1174166059 20:48584293-48584315 AAAGCCCTTTGGAGCCCCCAGGG - Intergenic
1174904903 20:54540113-54540135 AAGTCCCTTTGGAAGCCCCAGGG + Intronic
1175424061 20:58853348-58853370 AACCACCTTTGGAGGCCCCAGGG + Exonic
1176289191 21:5035263-5035285 AGCCACCTTTGGAAGACGCACGG + Intronic
1177755036 21:25335769-25335791 TACCACCTTTGCTAGCCCCAGGG + Intergenic
1178005659 21:28217314-28217336 AACAAGCCATGGAGGCCCCAGGG - Intergenic
1178532380 21:33386326-33386348 AAGCCGGTTTGGAGGCCCCAAGG - Intergenic
1179640843 21:42746390-42746412 TGCCACCTCTGAAGGCCCCAGGG + Intronic
1179868044 21:44228341-44228363 AGCCACCTTTGGAAGACGCACGG - Intronic
1180252371 21:46597834-46597856 AGCCACCTGGGGAGTCCCCAGGG - Intergenic
1181525241 22:23480449-23480471 AACCAGCATTGGAGGCATCATGG - Intergenic
1183506842 22:38214140-38214162 AAGCACCTTTGAATGCCCCAGGG - Intronic
1183580103 22:38719554-38719576 CAGCACCTTGGGAGGCACCAAGG - Intronic
1183594842 22:38804924-38804946 AACCACCATTCCTGGCCCCAAGG - Intergenic
949877427 3:8635344-8635366 TCCCACCTTTGGAGGCCCCAGGG - Exonic
951678418 3:25268413-25268435 ATCCACTTTTGTAGGCCACATGG - Intronic
954201340 3:49025120-49025142 CCTCACCTGTGGAGGCCCCAAGG + Exonic
954425241 3:50439699-50439721 AACCACCTCAAGAGGCCACAGGG + Intronic
957553780 3:81739724-81739746 AACCAGTTTTGGAAGCCTCATGG - Intronic
962835358 3:139184694-139184716 AAGCACTTTGGGGGGCCCCAGGG + Intronic
964326935 3:155557115-155557137 GACCTCATTTGCAGGCCCCAAGG - Intronic
969488740 4:7486684-7486706 ATCCTCCTTTGGAGGCTCCAGGG - Intronic
986469478 5:8059975-8059997 AACCGCATCTGGAGGCCCCTAGG + Intergenic
988843985 5:35110892-35110914 ATCCAGCTTTGGAGAACCCAGGG - Intronic
990466793 5:56078495-56078517 AACAACCTCAGGAAGCCCCAGGG + Intergenic
997704231 5:135931295-135931317 AAACACCTTTGGAGACGCAAGGG - Intronic
998114250 5:139524337-139524359 AAGCCCCTTAGGAGGCTCCAGGG + Intergenic
998275428 5:140748037-140748059 CAGCACTTTGGGAGGCCCCAAGG - Intergenic
998287727 5:140879751-140879773 TACTCTCTTTGGAGGCCCCAGGG + Intronic
999125806 5:149244999-149245021 TACTACCTTTGGGGGACCCATGG - Exonic
999715717 5:154358287-154358309 CACCAGCCTTGGAGCCCCCAAGG - Intronic
1002908214 6:1468170-1468192 AACCATCTTTGGAGGAAGCATGG - Intergenic
1005982134 6:30844553-30844575 AAGCATCTTTGGAGGTCCCCAGG - Intergenic
1007667194 6:43521779-43521801 CAACACTTTGGGAGGCCCCAAGG - Intronic
1011664313 6:89620158-89620180 TACTACTTTTGGAGGCCTCAAGG + Intronic
1013426037 6:110013399-110013421 ACCCAGCTTTGGGGGCCACATGG + Intergenic
1013803388 6:113971156-113971178 AACCACCTCAGGAGGCCGCAGGG + Exonic
1018632515 6:165833521-165833543 CACCACCTGTGCATGCCCCAGGG + Intronic
1020111318 7:5449524-5449546 AACCATCTACTGAGGCCCCAGGG - Intronic
1023285472 7:38614719-38614741 AACCATCTTTCGAGGCACTAAGG + Intronic
1024399235 7:48904799-48904821 AACCACCTTTTCAGGCCCATAGG + Intergenic
1032997539 7:137464501-137464523 CACCACCTTTGGGGCTCCCAGGG + Intronic
1038594811 8:28878727-28878749 CAGCACTTTGGGAGGCCCCAAGG + Intronic
1039287182 8:36054815-36054837 AATCAGCTTTGTAGGGCCCAAGG + Intergenic
1039343868 8:36682454-36682476 CACCCCCTTTGCAGGCCTCAGGG + Intergenic
1040387242 8:46921749-46921771 CACCACCTGTGCAGACCCCAGGG - Intergenic
1040973878 8:53169001-53169023 TAACACTTTGGGAGGCCCCAGGG + Intergenic
1042383955 8:68151440-68151462 GGCCACATTTGTAGGCCCCAAGG + Intronic
1042563141 8:70088556-70088578 AACCACCTTAGGAGGTTGCAGGG + Intergenic
1045717063 8:105059527-105059549 AAGCACCTTTGAAGGTCACATGG - Intronic
1052744352 9:32425225-32425247 AATCACCTTGGGAGCCCGCAAGG + Intronic
1053300634 9:36946825-36946847 AACCAACTTGGAAAGCCCCATGG + Intronic
1058978619 9:110148437-110148459 CTCCTCCTTTGAAGGCCCCAGGG - Intronic
1059507684 9:114814511-114814533 ATCCTCCTGGGGAGGCCCCAAGG - Intergenic
1060781523 9:126416639-126416661 AACCACCTCCGGAGGACACATGG + Intronic
1062218732 9:135403141-135403163 CCCGACCCTTGGAGGCCCCAAGG - Intergenic
1185755985 X:2653343-2653365 AACAACTTTGGGAGGCCGCATGG - Intergenic
1188491171 X:30740240-30740262 AACCATCTCTGTAGTCCCCAGGG - Intergenic
1189224601 X:39402323-39402345 ACCCACCTTAGCAGGCTCCAGGG - Intergenic
1196491656 X:116274604-116274626 AAATTCCTTTGGATGCCCCAAGG + Intergenic
1197065593 X:122230085-122230107 TACCTCTTTTGGATGCCCCAGGG - Intergenic