ID: 1175424062

View in Genome Browser
Species Human (GRCh38)
Location 20:58853349-58853371
Sequence ACCACCTTTGGAGGCCCCAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1028
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 979}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424054_1175424062 4 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424055_1175424062 3 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424053_1175424062 5 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424052_1175424062 6 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979
1175424051_1175424062 7 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG 0: 1
1: 0
2: 3
3: 45
4: 979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424062 Original CRISPR ACCACCTTTGGAGGCCCCAG GGG Exonic
900029515 1:360742-360764 AGTACCTTTGGAGGCCCAGGTGG - Intergenic
900050116 1:589513-589535 AGTACCTTTGGAGGCCCAGGTGG - Intergenic
900148470 1:1168247-1168269 GCCACCTGTGGAGGCACCAAGGG - Intergenic
900245957 1:1636169-1636191 CCCATCTTTGGGGGACCCAGTGG - Intronic
900257182 1:1703312-1703334 CCCATCTTTGGGGGACCCAGTGG - Intronic
900281927 1:1875438-1875460 AGCACTTTGGGAGGCCACAGCGG - Intronic
900469480 1:2846425-2846447 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
900988024 1:6084566-6084588 AGCACTTTGGGAGGCCACAGTGG + Intronic
901272846 1:7966446-7966468 AGCACTTTTGGAGGCCAAAGTGG + Intronic
901345769 1:8540358-8540380 AGAACCTTAGGAGGCCACAGTGG - Intronic
901504005 1:9672671-9672693 ACCACTTTGGGAGGCCGAAGTGG - Intronic
901576281 1:10203523-10203545 AGCACTTTTGGAGGCCAAAGCGG + Intergenic
901675511 1:10881357-10881379 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
901731405 1:11282812-11282834 AGCACTTTGGGAGGCCACAGCGG - Intronic
901780481 1:11590986-11591008 AGCACTTTGGGAGGCCACAGTGG + Intergenic
901963163 1:12843487-12843509 AACACCTTGGGAGGCCAAAGCGG - Intergenic
901990355 1:13107808-13107830 AACACCTTGGGAGGCCAAAGCGG - Intergenic
902222080 1:14972760-14972782 AGCACTTTGGGAGGCCACAGTGG - Intronic
902412424 1:16219265-16219287 ACCCACTTTGGAGGCCCCAGAGG + Intergenic
903451677 1:23457758-23457780 AGCACCTTGGGAGGCCGAAGCGG - Intronic
903453188 1:23469055-23469077 AGCACTTTGGGAGGCCCAAGTGG + Intronic
903881074 1:26509788-26509810 AACACTTTGGGAGGCCCAAGTGG - Intergenic
904080079 1:27866728-27866750 AGCACTTTGGGAGGCCGCAGTGG + Intergenic
904165268 1:28550525-28550547 AGCACTTTGGGAGGCCACAGTGG + Intergenic
904528183 1:31150265-31150287 ACCACTTTGGGAGGCCCAGGTGG + Intergenic
904726456 1:32552114-32552136 AGCACTTTTGGAGGCCGAAGTGG + Intronic
905440320 1:37992434-37992456 CCCACCTGTGGGGGCCACAGGGG - Intergenic
906303807 1:44703433-44703455 ACCACCTTGGGCGGGCACAGTGG + Intronic
906490329 1:46263374-46263396 ACCTCCTTTGTATACCCCAGAGG + Intronic
906520384 1:46463624-46463646 AGCACTTTGGGAGGCCACAGTGG + Intergenic
906564949 1:46792693-46792715 CCCACCTTTGGAGTCCCCAGTGG - Intronic
906631235 1:47370162-47370184 AGCACTTTGGGAGGCCCAAGCGG - Intronic
906985057 1:50674196-50674218 AGCACTTTGGGAGGCCCAAGTGG - Intronic
907492796 1:54819616-54819638 AGCACTTTGGGAGGCCACAGTGG - Intronic
907888400 1:58615233-58615255 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
908464265 1:64376141-64376163 AGCACTTTTGGAGGCCAAAGAGG + Intergenic
909291574 1:73889717-73889739 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
909443862 1:75726158-75726180 AGCACCTTGGGAGGCCTCGGCGG + Intronic
909641905 1:77878144-77878166 AGCACTTTGGGAGGCCCAAGTGG + Exonic
910181047 1:84483512-84483534 AGCACTTTTGGAGGCCAAAGCGG - Intronic
910374634 1:86554510-86554532 AGCACCTTGGGAGGCCGCGGTGG - Intronic
910658558 1:89644396-89644418 AGCACTTTGGGAGGCCACAGCGG - Intronic
910883654 1:91944408-91944430 ACCACTTTGAGAGGCCTCAGTGG + Intergenic
911006726 1:93233842-93233864 AGCACTTTGGGAGGCCCAAGTGG - Intronic
911007363 1:93241200-93241222 AGCACCTTGGGAGGCCCAGGTGG - Intronic
911529034 1:99021592-99021614 AGCACTTTGGGAGGCCCTAGTGG + Intergenic
912407767 1:109455297-109455319 AACTCTTTTGGATGCCCCAGGGG + Intergenic
912710571 1:111946776-111946798 ACCACATATGGGGGCCCCACTGG + Intronic
912764957 1:112400411-112400433 AGCACTTTTGGAGGCCGAAGCGG + Intronic
913698809 1:121354643-121354665 AGCACCTTTTGAGGCCCAGGTGG - Intronic
914138736 1:144925394-144925416 AGCACCTTTTGAGGCCCAGGTGG + Intronic
914345783 1:146797324-146797346 ACAACCTTTGCAGTCCCCATTGG + Intergenic
914809934 1:151020078-151020100 ACCACTTTGGGAGGCCAAAGTGG - Intronic
914891848 1:151631920-151631942 AACACTTTGGGAGGCCGCAGTGG - Intronic
915173720 1:153997209-153997231 ACCACTTTGGGAGGCCGAAGTGG - Intronic
915385150 1:155484679-155484701 ACCACTTTTGGAGGCCGAGGTGG + Intronic
915806731 1:158861565-158861587 AGCACTTTGGGAGGCCACAGGGG + Intergenic
916529278 1:165640387-165640409 ACTATCTTTGGAGGCTCCTGAGG - Intronic
916536622 1:165709551-165709573 AGCACCTCTGGAGGCACGAGGGG - Intergenic
917099200 1:171428826-171428848 AGCACTTTTGGAGGCCTAAGTGG - Intergenic
917921897 1:179757562-179757584 AGCACCTTAGGAGGCCCAGGTGG + Intronic
917925743 1:179787844-179787866 ATCACCATGGGAAGCCCCAGGGG + Intronic
918289498 1:183093029-183093051 AGCACCTTGGGAGGCCCAGGTGG + Intronic
919168527 1:193925828-193925850 AGCACTTTGGGAGGCCACAGTGG - Intergenic
919488429 1:198173179-198173201 ACCACTTTGGGAGGCCGAAGTGG + Intronic
919682730 1:200452543-200452565 AGCACTTTTGGAGGCCCAGGCGG + Intergenic
920486218 1:206373341-206373363 AGCACCTTTTGAGGCCCAGGTGG - Intronic
920499154 1:206475485-206475507 AGCACTTTGGGAGGCCCAAGTGG + Intronic
920523140 1:206644280-206644302 AGCACTTTTGGAGGCCAAAGTGG - Intronic
920595306 1:207263385-207263407 AGCACTTTTGGAGGCCCAGGCGG - Intergenic
920703054 1:208232158-208232180 ACCACCTGTGCAAGCCCCTGGGG - Intronic
921064089 1:211610360-211610382 ATCACCTTGGGAGGCCGAAGCGG + Intergenic
921756138 1:218857896-218857918 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
921916961 1:220624048-220624070 AGCACTTTGGGAGGCCCAAGGGG + Intronic
923507209 1:234614896-234614918 AGCACTTTGGGAGGCCACAGTGG + Intergenic
923576333 1:235162015-235162037 AACACATTTGGAGGCCGAAGTGG + Intronic
923774481 1:236966216-236966238 AACACTTTGGGAGGCCACAGTGG + Intergenic
923895113 1:238260962-238260984 AGCACTTTTGGAGGCCGAAGCGG - Intergenic
924264844 1:242270788-242270810 GCCTCCTTTGGTTGCCCCAGTGG + Intronic
924541019 1:244980933-244980955 AGCACCTTGGGAGGCCCAGGCGG + Intronic
924554158 1:245104254-245104276 AGCACCTTGGGAGGCCCAGGCGG + Intronic
924759644 1:246971981-246972003 AGCACTTTGGGAGGCCCCGGTGG - Intronic
1063683480 10:8212793-8212815 AGCACTTTTGGAGGCCAAAGCGG - Intergenic
1063802432 10:9595762-9595784 AACACTTTGGGAGGCCCTAGTGG - Intergenic
1064080275 10:12302648-12302670 AGCACTTTGGGAGGCCGCAGCGG - Intergenic
1064371051 10:14751858-14751880 ACCTCCTTTGGAGGCGGAAGTGG - Intronic
1064450565 10:15438718-15438740 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1064469197 10:15618059-15618081 CCCAATTTTGGAGTCCCCAGTGG - Intronic
1064584697 10:16828468-16828490 AACACTTTCGGAGGCCCAAGCGG + Intronic
1064799991 10:19059637-19059659 AGCACTTTGGGAGGCCACAGTGG - Intronic
1065139340 10:22705285-22705307 GCCACCTTTGAAGGGCCAAGTGG - Intronic
1065293299 10:24252328-24252350 AGCACTTTGGGAGGCCCAAGAGG + Intronic
1065596042 10:27312205-27312227 AGCACTTTGGGAGGCCACAGCGG - Intergenic
1065876893 10:30004968-30004990 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1066335494 10:34473437-34473459 AGCACCTTGGGAGGCCAAAGTGG + Intronic
1066541120 10:36447793-36447815 ACCACTTTGGGAGGCCCAGGGGG + Intergenic
1066559552 10:36654308-36654330 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1066572740 10:36791116-36791138 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
1066652372 10:37669144-37669166 AGCACTTTTGGAGGCCCAGGTGG + Intergenic
1066719965 10:38327694-38327716 GCCTCCTTTGGTTGCCCCAGTGG - Intergenic
1067486922 10:46659259-46659281 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
1067980436 10:51078475-51078497 AGCACTTTTGGAGGCCCAGGTGG - Intronic
1068302837 10:55167361-55167383 AGCACCTTTGGAGGCCAAGGTGG - Intronic
1068458727 10:57297071-57297093 AGCACCTTGGGAGGCCCAAGCGG - Intergenic
1068933751 10:62616744-62616766 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1069075108 10:64030986-64031008 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1069132914 10:64728493-64728515 GCCAGGTTTGTAGGCCCCAGGGG - Intergenic
1069387585 10:67898021-67898043 AGCACTTTGGGAGGCCACAGCGG + Intronic
1069436465 10:68388587-68388609 AACACTTTAGGAGGCCACAGTGG + Intronic
1069800761 10:71080220-71080242 GCCAACTCTGGAGGCCCCAAAGG + Intergenic
1069946838 10:71992427-71992449 ATCACTTTGGGAGGCCCAAGCGG - Intronic
1070245591 10:74728581-74728603 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1070610815 10:77931201-77931223 AGCACTTTGGGAGGCCCAAGAGG - Intergenic
1070723686 10:78773735-78773757 AGCACCTTGGGAGGCCGAAGCGG + Intergenic
1070808788 10:79286859-79286881 ACCCCCATGGGAGGCCCCAGGGG - Intronic
1071214771 10:83388027-83388049 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1071293551 10:84203743-84203765 AACACTTTTTGAGGACCCAGTGG + Intronic
1071548362 10:86546003-86546025 AGCACTTTGGGAGGCCGCAGCGG - Intergenic
1071620071 10:87111087-87111109 AGCACGTTGGGAGGCCACAGTGG - Intronic
1071707399 10:88013892-88013914 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1071950039 10:90692939-90692961 ACCACTTTGGGAGGCCCAGGCGG - Intergenic
1072031548 10:91526752-91526774 ACCAACTTTGGTTCCCCCAGAGG + Intergenic
1072078064 10:91998801-91998823 AGCACTTTGGGAGGCCACAGTGG + Intronic
1072316139 10:94205203-94205225 ACCACCTTTCCATTCCCCAGGGG + Intronic
1072337782 10:94414845-94414867 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1072520436 10:96225890-96225912 AGCACTTTGGGAGGCCACAGTGG - Intronic
1072971923 10:100024754-100024776 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1073201267 10:101737831-101737853 AGCACCTTGGGAGGCCAAAGTGG - Intergenic
1073310829 10:102540401-102540423 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1073881685 10:107988583-107988605 ACCACTTTTGGAGGCCAAAGTGG - Intergenic
1074325889 10:112450137-112450159 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1074411297 10:113230749-113230771 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1075003270 10:118813303-118813325 AGCACCTTGGGAGGCCGAAGTGG + Intergenic
1075115988 10:119627555-119627577 ACCACCGTGGGTGGCTCCAGGGG + Intergenic
1075730006 10:124630471-124630493 ACCACCTTTGGACCCCAAAGAGG + Intronic
1075919078 10:126195325-126195347 AGCACCTTGGGAGGCCCAGGTGG + Intronic
1076203061 10:128573214-128573236 ACCATCCTGGGAGGCCCCAGGGG - Intergenic
1077179788 11:1207181-1207203 ACCACCCCTGCAGGCCCCGGGGG + Intergenic
1077261135 11:1621704-1621726 GCCTCCTTTGGAGCCCCCACAGG + Exonic
1077609177 11:3633896-3633918 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1078205302 11:9223942-9223964 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1078844228 11:15107149-15107171 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1078875438 11:15390627-15390649 AGCACCTTGGGAGGCCAAAGTGG + Intergenic
1079784526 11:24654770-24654792 AGCACTTTTGGAGGCCGAAGCGG - Intronic
1079812792 11:25016165-25016187 AGCACTTTTGGAGGCCGAAGTGG - Intronic
1081140990 11:39499614-39499636 ACCACTTTGGGAGGCCGAAGTGG - Intergenic
1081284675 11:41253129-41253151 ACCAACTTTGAAGGCACCAATGG + Intronic
1081395499 11:42581967-42581989 ACTCCCTCTGGAGGCCCCAGAGG + Intergenic
1081419304 11:42853852-42853874 AGCACCTTGGGAGGCCAGAGGGG - Intergenic
1081707673 11:45194448-45194470 AGCATCTTTGGAGGACCCACTGG - Intronic
1081806707 11:45894826-45894848 TCCACCTTTGGAGCAGCCAGGGG + Intronic
1081898522 11:46608049-46608071 AGCACTTTGGGAGGCCACAGTGG + Intronic
1082784032 11:57307020-57307042 ACCACCTTTCGACCCTCCAGCGG + Intronic
1082963285 11:58939563-58939585 GCCAGCTGTGGTGGCCCCAGAGG - Intronic
1083190716 11:61050092-61050114 ACAACCCTGGGAGGCCACAGAGG - Intergenic
1083384581 11:62298133-62298155 AGCACTTTGGGAGGCCACAGTGG - Intronic
1083467505 11:62858467-62858489 AGCACCTTGGGAGGCCAAAGTGG + Intronic
1083639934 11:64140050-64140072 GCCAGCTTTGGAGGTCCCAGAGG - Intronic
1083866541 11:65457509-65457531 ACCACTTTGGGAGGCCGAAGCGG + Intergenic
1084803952 11:71565934-71565956 GCCACCTTTGGAGCCCCCACAGG - Exonic
1084806468 11:71582640-71582662 GCCCCCTTTGGAGCCCCCACAGG + Exonic
1085108030 11:73862666-73862688 AGCACTTTTGGAGGCCAAAGTGG + Intronic
1085592497 11:77777342-77777364 AGCACTTTTGGAGGCTGCAGCGG + Intronic
1086818151 11:91399781-91399803 AGCACCTTGGGAGGCCCAGGTGG - Intergenic
1087025506 11:93645467-93645489 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1087492574 11:98846803-98846825 AGCACCTTAGGAGGCCGAAGTGG - Intergenic
1087659486 11:100970234-100970256 ACCACTTTTGGAGGCCAAGGCGG - Intronic
1087784102 11:102334991-102335013 AGCACTTTTGGAGGCCGGAGTGG + Intronic
1088622329 11:111698492-111698514 AGCACTTTGGGAGGCCACAGCGG + Intronic
1088723258 11:112612790-112612812 ACCACACCTGCAGGCCCCAGGGG + Intergenic
1088885740 11:114005061-114005083 AACACTTTGGGAGGCCACAGTGG - Intergenic
1089172791 11:116527172-116527194 AACACTTTGGGAGGCCACAGTGG + Intergenic
1089234669 11:117013241-117013263 ACCACTTTGGGAGGCCAAAGTGG + Intronic
1089493163 11:118895967-118895989 AGCTCCTTGGGAGGCCCCACTGG + Exonic
1089805609 11:121085751-121085773 AGCACCTTGGGAAGCCCAAGGGG - Intronic
1090058605 11:123444608-123444630 ACCACTTTAGGAGACCCAAGGGG - Intergenic
1090949492 11:131460799-131460821 AGCACTTTGGGAGGCCCAAGCGG - Intronic
1090982417 11:131735061-131735083 AGCACCTCTGGAGACCTCAGTGG - Intronic
1091024166 11:132127148-132127170 ACCACCTTTCGATCCACCAGAGG - Intronic
1091547119 12:1508688-1508710 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
1091657762 12:2358106-2358128 ATCAGCTATGGAGGCCTCAGAGG + Intronic
1092127209 12:6083321-6083343 AGCACTTTTGGAGGCCAAAGTGG + Intronic
1092236757 12:6815250-6815272 GTCTCCTTTGGAGGCCCCAAAGG + Intronic
1092361530 12:7840631-7840653 AGCACCTTGGGAGGCCCAGGTGG - Intronic
1092791531 12:12074888-12074910 ACCACCTTAGGAGGCCAAGGTGG - Intronic
1093783182 12:23160938-23160960 AGCACTTTTGGAGGCCAAAGTGG + Intergenic
1094007746 12:25773406-25773428 AGCACTTTGGGAGGCCACAGCGG - Intergenic
1094019393 12:25897832-25897854 ACCACTTTGGGAGGCCCAGGTGG - Intergenic
1094200015 12:27785454-27785476 AGCACTTTGGGAGGCCACAGTGG - Intronic
1094205237 12:27832580-27832602 AGCACTTTGGGAGGCCCAAGAGG - Intergenic
1094787815 12:33871164-33871186 AGCACTTTGGGAGGCCGCAGAGG - Intergenic
1095300510 12:40579381-40579403 AGCACCTTGGGAGGCCCAGGTGG + Intergenic
1095737899 12:45577540-45577562 ACAACCTGTGGAGGCACAAGGGG - Intergenic
1096068483 12:48760042-48760064 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1096083204 12:48847267-48847289 AGCACTTTTGGAGGCCAAAGCGG + Intronic
1096124247 12:49108015-49108037 AGCACTTTGGGAGGCCACAGTGG + Intronic
1096162778 12:49394098-49394120 ACCACTTTGGGAGGCCATAGTGG + Intronic
1096221554 12:49832171-49832193 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1096304846 12:50465122-50465144 AGCACTTTGGGAGGCCCCGGTGG + Intronic
1096396905 12:51273045-51273067 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1096404461 12:51333339-51333361 AGCACTTTGGGAGGCCACAGTGG - Intronic
1096447106 12:51703389-51703411 AGCACTTTGGGAGGCCACAGTGG - Intronic
1096780218 12:53987339-53987361 ACCACCTTTGCAGACCCAAGGGG - Intronic
1097009030 12:55939434-55939456 AGCACATGTGGAGGCCCAAGAGG + Exonic
1097080515 12:56427368-56427390 AGCACTTTGGGAGGCCACAGTGG - Intronic
1097108428 12:56639524-56639546 ACCACTTTGGGAGGCCACGGTGG + Intronic
1097382899 12:58916948-58916970 AGCAGCTCTGCAGGCCCCAGTGG - Intronic
1097594818 12:61616085-61616107 AGCACTTTTGGAGGCCAAAGTGG + Intergenic
1098236609 12:68424057-68424079 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1100497846 12:95142523-95142545 AGCACTTTGGGAGGCCCTAGTGG - Intronic
1100635893 12:96434164-96434186 AACACTTTTGGAGGCCAAAGAGG - Intergenic
1100760211 12:97798837-97798859 ACCACTTTGGGAGGCCAAAGCGG - Intergenic
1101352486 12:103944799-103944821 AGCACTTTGGGAGGCCGCAGAGG - Intronic
1101894009 12:108741228-108741250 AGCACTTTTGGAGGCCGAAGTGG + Intergenic
1101934584 12:109046942-109046964 ACCACTTTGGGAGGCCCAGGCGG - Intronic
1102074092 12:110046178-110046200 AGCACTTTGGGAGGCCACAGTGG + Intronic
1102156114 12:110729438-110729460 AGCACTTTGGGAGGCCACAGCGG - Intronic
1102324258 12:111965675-111965697 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1102782385 12:115576378-115576400 ACCCCATTTAGAGCCCCCAGGGG + Intergenic
1102981569 12:117245668-117245690 AGCACTTTGGGAGGCCCCGGGGG + Intronic
1103091421 12:118100774-118100796 AGCACTTTTGGAGGCCGAAGTGG - Intronic
1103228392 12:119307459-119307481 AGCACTTTGGGAGGCCCAAGGGG + Intergenic
1103341288 12:120222518-120222540 CCCACCTGGGGAGGGCCCAGTGG + Intronic
1103457594 12:121078590-121078612 AGCACTTTGGGAGGCCGCAGTGG + Intergenic
1103611146 12:122124781-122124803 ACCACTTTTGGAGGCCGAGGTGG + Intronic
1103681565 12:122698438-122698460 AGCACTTTTGGAGGCCAAAGCGG - Intergenic
1103683316 12:122711876-122711898 AGCACTTTTGGAGGCCAAAGCGG - Intergenic
1103809237 12:123600842-123600864 ACCACTTTGGGAGGCCAAAGCGG - Intergenic
1104673337 12:130695492-130695514 ACCACTCTTGGAGGCCAAAGTGG + Intronic
1105383152 13:19905891-19905913 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1105557884 13:21463202-21463224 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1105559867 13:21480402-21480424 ACCAGCTTAGGAGACTCCAGGGG - Intergenic
1105701335 13:22937664-22937686 ACCAGCTTTGGGGACTCCAGTGG + Intergenic
1105750235 13:23416508-23416530 AGCACTTTGGGAGGCCACAGAGG + Intronic
1105984780 13:25554805-25554827 ACCACTTTGGGAGGCCGAAGTGG - Intronic
1106352894 13:28951549-28951571 AGCACTTTGGGAGGCCACAGTGG + Intronic
1106446217 13:29833938-29833960 AGCACTTTGGGAGGCCGCAGCGG + Intronic
1107152566 13:37128978-37129000 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1107153374 13:37138402-37138424 ACTCCCTCTGGAGGCTCCAGGGG - Intergenic
1107371025 13:39748365-39748387 AGCACTTTGGGAGGCCACAGTGG + Intronic
1107391795 13:39972576-39972598 ATCACCTTGGGAGGCCAAAGGGG + Intergenic
1109826070 13:67723700-67723722 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1110105800 13:71674587-71674609 ACCCCCTCTGGAGGCTCTAGGGG - Intronic
1110142164 13:72143836-72143858 ACTCCCTTTGGAGGCTCCTGGGG - Intergenic
1110774251 13:79388341-79388363 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1111025109 13:82510519-82510541 AGCACTTTGGGAGGCCCCGGCGG - Intergenic
1111114957 13:83763721-83763743 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
1111648192 13:91058162-91058184 GCCACCCTTGGATGCCCCATGGG - Intergenic
1111730138 13:92064508-92064530 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1111835128 13:93378746-93378768 ACCGCTTTGGGAGGCCGCAGCGG + Intronic
1111914456 13:94346473-94346495 ACCACATTGGGAGGCCCAGGTGG + Intronic
1112048714 13:95623691-95623713 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1112060089 13:95730239-95730261 ACCACTTTGGGAGGCCAAAGTGG - Intronic
1112064558 13:95779369-95779391 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1112393922 13:99011142-99011164 AGCACCTTGGGAGGCCGAAGTGG - Intronic
1112456411 13:99567171-99567193 ACCACTTTGGGAGGCCGAAGCGG + Intergenic
1112523602 13:100121405-100121427 AGCACTTTGGGAGGCCACAGCGG - Intronic
1114622175 14:24102823-24102845 CCCAGCCTGGGAGGCCCCAGAGG + Exonic
1114875294 14:26710041-26710063 AGCACTTTGGGAGGCCGCAGTGG + Intergenic
1115022463 14:28699259-28699281 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
1115206357 14:30909723-30909745 ACCACTTTGGGAGGCCGAAGTGG - Intronic
1115212307 14:30980000-30980022 ACCACCTTGGGAGGCCAAGGTGG + Intronic
1115480538 14:33856877-33856899 TCCACCTCTGGAAGTCCCAGCGG + Intergenic
1115626819 14:35201903-35201925 AGCACCTTGGGAGGCCCAAGTGG - Intronic
1116215150 14:42007021-42007043 AGCACTTTGGGAGGCCCAAGCGG - Intergenic
1116381848 14:44278724-44278746 AGCACTTTTGGAGGCCGAAGCGG - Intergenic
1116836804 14:49776669-49776691 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1117426344 14:55601981-55602003 AGCACCTTCAGAGGCCACAGCGG - Intronic
1117968806 14:61232466-61232488 ACCACTTTGGGAGGCCAAAGCGG - Intronic
1117998465 14:61500443-61500465 AGCACTTTAGGAGGCCACAGTGG - Intronic
1118614143 14:67563678-67563700 AGCACTTTGGGAGGCCCAAGAGG - Intronic
1118976208 14:70678906-70678928 ACTACCTTTGGAAGCCCAAACGG + Intergenic
1118998745 14:70861817-70861839 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1119088226 14:71756089-71756111 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1119140909 14:72266254-72266276 ACCATGTGTGGAAGCCCCAGTGG - Intronic
1119280945 14:73407088-73407110 AGCACCTTGGGAGGCCCAGGTGG - Intronic
1119677356 14:76565878-76565900 AGCACCTTTGGAGGCCGAGGTGG + Intergenic
1119718084 14:76872932-76872954 TCCACCTTTGGAGGCTCCCAGGG - Intergenic
1119833029 14:77720380-77720402 AACACATTTGGAGGCCGAAGCGG - Intronic
1119983989 14:79115076-79115098 AGCACTTTGGGAGGCCACAGAGG + Intronic
1120803046 14:88714083-88714105 AGCACTTTGGGAGGCCACAGTGG - Intronic
1120997921 14:90430496-90430518 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1121262929 14:92579751-92579773 ACCAGACTTGGAGGCCCCTGAGG - Intronic
1122234070 14:100322352-100322374 CCCGCCTGGGGAGGCCCCAGAGG - Intergenic
1122394061 14:101410220-101410242 GCTACCTCTGGAGGCCACAGTGG - Intergenic
1122487636 14:102091872-102091894 AGCACTTTGGGAGGCCACAGTGG - Intronic
1122521751 14:102349003-102349025 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1122613296 14:103000430-103000452 ACAGTCTGTGGAGGCCCCAGTGG + Intronic
1122757265 14:103991656-103991678 AGCACTTTGGGAGGCCACAGCGG - Intronic
1122857620 14:104567423-104567445 AGCACCTAAGGAGGCCCCTGGGG + Intronic
1123771764 15:23536375-23536397 ACCAACTTTGGAACCCTCAGAGG - Intergenic
1123847892 15:24322785-24322807 AGCACTTTTGGAGGCCCAAATGG - Intergenic
1123866938 15:24530154-24530176 AGCACTTTTGGAGGCCCAAATGG - Intergenic
1124134415 15:27021591-27021613 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1124985772 15:34611079-34611101 ACCACTTTGGGAGGCCGAAGCGG - Intergenic
1126113892 15:45191433-45191455 AGCACTTTGGGAGGCCCAAGCGG - Intronic
1127459195 15:59182458-59182480 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1127919606 15:63483207-63483229 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1127949011 15:63785951-63785973 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1128154608 15:65384804-65384826 TCAACCTTTGGAGGCTCCAGGGG + Intronic
1128452051 15:67811418-67811440 ACCACCCTGTGGGGCCCCAGGGG - Intergenic
1129003063 15:72350009-72350031 ACCACTTTTGGAGGCCAAGGCGG - Intronic
1129326299 15:74801904-74801926 CCCACCTCTGTAGGCCCCAGGGG - Intronic
1129488741 15:75903506-75903528 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
1129809299 15:78494818-78494840 AGCACCCTGGGAGGCCACAGCGG - Intronic
1129810109 15:78503558-78503580 AGCACTTTGGGAGGCCCCGGTGG - Intergenic
1130003474 15:80068617-80068639 AGCACTTTGGGAGGCCACAGTGG - Intronic
1130307752 15:82726121-82726143 AGCACTTTTGGAGGCCCAGGCGG - Intergenic
1130577826 15:85107900-85107922 ACCACCTTTGGAAACACCAGGGG + Intronic
1130622293 15:85476249-85476271 ACACTCTTTGGAGGCACCAGAGG + Intronic
1130646981 15:85737165-85737187 AGCACTTTTGGAGGCCCAGGTGG - Intronic
1131217212 15:90548134-90548156 ACCACTTTGGGAGGCCACGGCGG - Intronic
1131695208 15:94869107-94869129 AGCACTTTGGGAGGCCACAGCGG + Intergenic
1131781424 15:95863961-95863983 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1131801825 15:96077196-96077218 ACCACTTTGGGAGGCCGAAGGGG + Intergenic
1132392019 15:101446080-101446102 ACCACCTCTGGAGGCAGCAGCGG + Intronic
1133330991 16:4973929-4973951 AGCACTTTGGGAGGCCTCAGGGG - Intronic
1133452768 16:5917536-5917558 ACCACCTGTGGGAGCCACAGTGG + Intergenic
1133808384 16:9142734-9142756 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1133939880 16:10300255-10300277 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1133952132 16:10404788-10404810 AGCACCTTGGGAGGCCAAAGTGG - Intronic
1134228467 16:12410679-12410701 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1134271494 16:12736940-12736962 AGCACCTTGGGAGGCCCAGGTGG + Intronic
1134484655 16:14647990-14648012 AGCACTTTGGGAGGCCCCGGTGG + Intronic
1134750261 16:16619590-16619612 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
1135039780 16:19109251-19109273 GCTCCCTTTTGAGGCCCCAGGGG - Intergenic
1135041791 16:19123028-19123050 AGCACTTTTGGAGGCCTCAGCGG + Intronic
1135087273 16:19485543-19485565 ATCACTTTTGGAGGCCGAAGCGG - Intronic
1135190037 16:20347268-20347290 AGCACTTTGGGAGGCCGCAGCGG - Intronic
1135253512 16:20921645-20921667 AGCACTTTTGGAGGCCACGGTGG - Intronic
1135296037 16:21280130-21280152 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1135422095 16:22312245-22312267 AGCACTTTTGGAGGCCGAAGTGG + Intronic
1135457505 16:22611200-22611222 ACCAACTTTGGAGACTCCACTGG - Intergenic
1135558715 16:23458532-23458554 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
1135681551 16:24461671-24461693 AGCACTTTTGGAGGCCCAGGTGG - Intergenic
1135734761 16:24921845-24921867 ACCACCTTTGGCTGCACCATAGG - Intronic
1135936591 16:26785737-26785759 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1137254618 16:46764742-46764764 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1137259425 16:46811994-46812016 AGCACCTTGGGAGGCCAAAGGGG + Intronic
1137310245 16:47249168-47249190 ACCACTTTGGGAGGCCAAAGTGG + Intronic
1137932670 16:52603637-52603659 AGCACTTTGGGAGGCCCCAGCGG - Intergenic
1138021136 16:53482560-53482582 AACACTTTGGGAGGCCACAGTGG + Intronic
1138877219 16:60966555-60966577 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1139561579 16:67745907-67745929 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1139808120 16:69587321-69587343 AGCACCTTGGGAGGCCGAAGTGG - Intronic
1139857856 16:69994859-69994881 AGCACTTTGGGAGGCCGCAGTGG + Intergenic
1139910790 16:70396215-70396237 ACCACCTTGGGAGGCCAAGGCGG - Intronic
1139917109 16:70435346-70435368 AGCACTTTCGGAGGCTCCAGCGG + Intronic
1139988204 16:70917943-70917965 ACAACCTTTGCAGTCCCCATTGG - Intronic
1140133737 16:72186863-72186885 AGCACTTTGGGAGGCCTCAGTGG + Intergenic
1140206763 16:72939638-72939660 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1140213503 16:72989235-72989257 AGCACCTTGGGAGGCCGAAGCGG + Intronic
1140499238 16:75418879-75418901 ACCACCTTAGGAGGCCAAGGTGG + Intronic
1140531249 16:75668472-75668494 AGCACTTTGGGAGGCCACAGTGG - Intronic
1140742344 16:77952609-77952631 AGCACCTTGGGAGGCCGAAGTGG + Intronic
1140791052 16:78391598-78391620 AGCACCTGGGGAGGCCGCAGTGG + Intronic
1140994864 16:80249239-80249261 ACCCCCTTTAGGGTCCCCAGAGG - Intergenic
1141193409 16:81841486-81841508 AGCACCTTGGGAGGCCGAAGTGG - Intronic
1141318830 16:82987622-82987644 ACCACTTTGGGAGGCCAAAGCGG - Intronic
1141334340 16:83140700-83140722 AGCACTTTTGGAGGCCCAGGCGG - Intronic
1141680060 16:85538636-85538658 GCCACCTTCGGAGGCCCCTGTGG + Intergenic
1142187848 16:88702901-88702923 TCCACCTGGGGAGGCCTCAGGGG + Intronic
1142390159 16:89794302-89794324 ACCACTTTGGGAGGCCGAAGTGG + Intronic
1142977286 17:3653162-3653184 ACCACTTTGGGAGGCCGAAGCGG + Intronic
1143029740 17:3961328-3961350 CCCACCTTTGCAGGTGCCAGAGG - Intronic
1143063271 17:4221862-4221884 AGCACTTTGGGAGGCCACAGTGG - Intronic
1143134825 17:4706306-4706328 ATCACATTTGGAAGCCACAGAGG - Intergenic
1143177728 17:4966223-4966245 ACCACTTTGGGAGGCCGCGGCGG - Intronic
1143212596 17:5199690-5199712 AGCACTTTGGGAGGCCTCAGTGG + Intergenic
1143534279 17:7526620-7526642 ACCACTTTGGGAGGCCAAAGTGG - Intergenic
1143608585 17:8004548-8004570 ACCACCAGATGAGGCCCCAGAGG - Intronic
1143695649 17:8614562-8614584 AACACTTTGGGAGGCCCAAGTGG - Intronic
1143882415 17:10039837-10039859 ACCCCCTCTGGGAGCCCCAGAGG - Intronic
1143929545 17:10407591-10407613 AGCACCTTAGGAGGCCAAAGCGG + Intronic
1144102164 17:11951431-11951453 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1144140681 17:12344278-12344300 ACCACTTTGGGAGGCCGAAGTGG - Intergenic
1145033320 17:19522055-19522077 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1145096099 17:20028385-20028407 AGCACTTTGGGAGGCCACAGTGG + Intronic
1145811479 17:27766797-27766819 AGCACTTTTGGAGGCCGCGGTGG + Intronic
1145836481 17:27957781-27957803 ACCACCTTTGAAGGCCAAGGGGG - Intergenic
1146058907 17:29594285-29594307 ACCCTCTTGGGAGGCCCCAAGGG + Intronic
1146835517 17:36107698-36107720 ACTCCCTTTGGAGGCTCTAGGGG - Intergenic
1146850146 17:36214969-36214991 ACTCCCTTTGGAGGCTCTAGGGG - Intronic
1146994600 17:37307833-37307855 ACCACCTTGGGAGGCCAAGGTGG - Intronic
1147117512 17:38312616-38312638 AGCACTTTTGGAGGCCGAAGTGG + Intronic
1147136648 17:38437947-38437969 ACCATCTTTGGAGGAGGCAGGGG - Intronic
1147172011 17:38626836-38626858 ACCACTTTTGGAGGCCGAGGCGG - Intergenic
1147244562 17:39111530-39111552 AGCACCTTGGGAGGCCCAGGTGG - Intronic
1147291768 17:39449426-39449448 AGCACCTTGGGAGGCCGAAGCGG - Intronic
1147688826 17:42302998-42303020 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1147715570 17:42505583-42505605 AGCACTTTGGGAGGCCACAGCGG - Intronic
1147729099 17:42586256-42586278 ATCACCTTTGGATGCAACAGTGG - Intronic
1147764675 17:42825570-42825592 AGCACTTTGGGAGGCCACAGTGG - Intronic
1147855615 17:43477424-43477446 ACCACCTTGGGAGGCCAAGGTGG + Intergenic
1147981687 17:44278687-44278709 AGCACTTTGGGAGGCCCCGGCGG + Intergenic
1148065458 17:44866055-44866077 AGCACTTTGGGAGGTCCCAGTGG - Intronic
1148412174 17:47476974-47476996 AGCACTTTTGGAGGCCGAAGTGG - Intergenic
1148728439 17:49814137-49814159 AGCACCTTGGGAGGCCGAAGTGG - Intronic
1148912658 17:50951175-50951197 AGCACTTTGGGAGGCCCCGGTGG + Intergenic
1149266501 17:54933134-54933156 TCCACTTTTGGACGCTCCAGAGG + Intronic
1149538404 17:57450427-57450449 AGCACTTTGGGAGGCCACAGCGG + Intronic
1149584820 17:57779140-57779162 AGCACTTTTGGAGGCCAAAGCGG + Intergenic
1149736853 17:59003122-59003144 ACCACTTTAGGAGGCCAAAGCGG - Intronic
1149771525 17:59325873-59325895 ACCACTTTGGGAGGCCCAGGCGG - Intergenic
1149802516 17:59583631-59583653 AGCACTTTGGGAGGCCACAGTGG + Intronic
1149843975 17:59991861-59991883 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1149876705 17:60241244-60241266 AGCACTTTGGGAGGCCACAGTGG - Intronic
1149878382 17:60262437-60262459 AGCACTTTGGGAGGCCACAGTGG - Intronic
1149959589 17:61093337-61093359 CCCACCTTGGGAGGCCCAAGTGG + Intronic
1149976612 17:61272055-61272077 AGCACTTTTGGAGGCCCAGGTGG - Intronic
1149976850 17:61274534-61274556 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1150046050 17:61914450-61914472 AGCACTTTGGGAGGCCACAGAGG + Intronic
1150433283 17:65135921-65135943 AGCACTTTGGGAGGCCCAAGCGG - Intergenic
1150499844 17:65640083-65640105 AGCACTTTGGGAGGCCACAGCGG - Intronic
1150570111 17:66378073-66378095 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1150669277 17:67176586-67176608 AGCACCTTGGGAGGCCAGAGCGG + Intronic
1150806889 17:68326417-68326439 AGCACTTTTGGAGGCCCAGGTGG + Intronic
1150829380 17:68505563-68505585 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1150915835 17:69435913-69435935 AGCACTTTGGGAGGCCACAGAGG - Intronic
1151519124 17:74615836-74615858 AGCACCTTGGGAGGCCAAAGCGG + Intronic
1152714850 17:81894029-81894051 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1152950242 17:83225818-83225840 AGTACCTTTGGAGGCCCAGGTGG + Intergenic
1153029723 18:702323-702345 ACCACTTTGGGAGGCCAAAGTGG + Intronic
1153264832 18:3260224-3260246 AGCACTTTTGGAGGCCCAGGTGG + Intergenic
1153274939 18:3359295-3359317 ACCAGCTTTGGAGGAAGCAGAGG - Intergenic
1153732276 18:8026607-8026629 AACACTTTTGGAGGCCAAAGTGG + Intronic
1154042446 18:10870121-10870143 AGCACCTTGGGAGGCCCAGGTGG - Intronic
1154163625 18:11997918-11997940 AGCACTTTTGGAGGCAGCAGTGG + Intronic
1154250709 18:12742061-12742083 AGCACTTTTGGAGGCCGAAGGGG - Intergenic
1154326228 18:13392686-13392708 ACCACCCTTGGATGCTGCAGAGG + Intronic
1155294523 18:24372814-24372836 AGCACCTTGGGAGGCCAAAGTGG + Intronic
1155462880 18:26103271-26103293 AGCACTTTGGGAGGCCCAAGCGG - Intergenic
1155701127 18:28745381-28745403 AGCACTTTTGGAGGCCCAGGAGG + Intergenic
1156779617 18:40835828-40835850 AGCACTTTGGGAGGCCACAGCGG + Intergenic
1156931540 18:42650568-42650590 AGCACTTTTGGAGGCCCAGGCGG + Intergenic
1159208254 18:65281657-65281679 ACCACTTTTGGAGGCCGAGGTGG + Intergenic
1159414565 18:68127174-68127196 ACCACTTTAGGAGGCCAAAGTGG + Intergenic
1160375670 18:78409967-78409989 ACCACCATCTGAGGCCCGAGTGG - Intergenic
1160715912 19:576512-576534 AGCACTTTGGGAGGCCCAAGAGG + Intronic
1160751868 19:738141-738163 AGCACCTTTGGAGGCCAAGGCGG + Intronic
1160753214 19:744930-744952 AGCACCTTGGGAGGCCAAAGTGG + Intronic
1160756607 19:760610-760632 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1160759435 19:775543-775565 AACACTTTGGGAGGCCGCAGTGG + Intergenic
1161269114 19:3379927-3379949 AGCACTTTGGGAGGCCACAGTGG - Intronic
1161354679 19:3812325-3812347 AGCACTTTTGGAGGTCCAAGTGG - Intronic
1161367797 19:3890970-3890992 ACCACTTCTGCAGTCCCCAGGGG - Intronic
1161406930 19:4096020-4096042 AGCACTTTGGGAGGCCACAGTGG - Intronic
1161434541 19:4254808-4254830 AGCACTTTTGGAGGCCGAAGTGG + Intronic
1161505310 19:4640453-4640475 AACGCCTTGGGAGGCCCCAGGGG + Intronic
1161807794 19:6455039-6455061 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1161859938 19:6790481-6790503 TTCTCCTTTGGAGCCCCCAGAGG - Intronic
1161919874 19:7258071-7258093 AGCACCTTGGGAGGCCGAAGCGG - Intronic
1162151857 19:8651778-8651800 AGCACTTTGGGAGGCCGCAGAGG - Intergenic
1162292011 19:9787027-9787049 AGCACATTTGGAGGCCGAAGTGG + Intronic
1162346075 19:10118932-10118954 ACCTCCTTGGGAGGCGGCAGTGG + Exonic
1162595164 19:11623016-11623038 AGCACTTTGGGAGGCCCAAGCGG - Intergenic
1162679334 19:12328237-12328259 ACCACTTTGGGAGGCCAAAGTGG + Intronic
1163163642 19:15480463-15480485 GACACCTGAGGAGGCCCCAGGGG - Intronic
1163213873 19:15862337-15862359 AGCACTTTTGGAGGCCAAAGTGG + Intergenic
1163222269 19:15930179-15930201 ACCACATCTGGAGGCTGCAGGGG - Intronic
1163301965 19:16453350-16453372 AGCACCGTGGGAGGCCCCGGTGG - Intronic
1163477726 19:17536650-17536672 AGCACCTTTGGAGGCTGAAGTGG - Intronic
1163508427 19:17721427-17721449 AGCACTTTGGGAGGCCGCAGCGG + Intronic
1164002827 19:21120285-21120307 AGCACCTTTGGAGGCCAAGGTGG - Exonic
1164039975 19:21485634-21485656 AGCACTTTTGGAGGCCACGGAGG - Intronic
1164040581 19:21489312-21489334 AGCACTTTTGGAGGCCACAGTGG - Intronic
1164282543 19:23781584-23781606 ACCACCTTGGGAGGCCGAGGTGG - Intronic
1164746344 19:30617595-30617617 AGCACTTTGGGAGGCCACAGTGG - Intronic
1164796869 19:31040615-31040637 AGCACTTTGGGAGGCCCAAGCGG + Intergenic
1165057583 19:33187838-33187860 AGCACTTTGGGAGGCCCAAGCGG - Intronic
1165092728 19:33395283-33395305 ACCACCCTTGCAAGGCCCAGAGG - Intronic
1165300463 19:34964937-34964959 GCCAGCATTGGAGTCCCCAGAGG - Intergenic
1165304217 19:34993786-34993808 ACCACTTTTGGAGGCCGAGGTGG + Intergenic
1165335787 19:35168773-35168795 ACCTCCTTGGCAGGCCACAGTGG + Intronic
1165524140 19:36338436-36338458 AGCACCTTTGGAGGCCAAGGAGG + Exonic
1165867734 19:38949345-38949367 AGCACTTTGGGAGGCCCGAGGGG - Intronic
1165905225 19:39189713-39189735 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1166191051 19:41176893-41176915 AGCACATTGGGAGGCCCAAGTGG - Intergenic
1166210749 19:41305289-41305311 ACCACCTGTTGAGTACCCAGTGG + Intronic
1166273721 19:41735820-41735842 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1166285278 19:41822310-41822332 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1166705335 19:44905330-44905352 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1166808972 19:45504265-45504287 ACCACTTTGGGAGGCCCAGGTGG + Intergenic
1166820100 19:45573913-45573935 AACACTTTGGGAGGCCACAGCGG + Intronic
1166950019 19:46420899-46420921 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1167088550 19:47327532-47327554 AGCACTTTTGGAGGCCAAAGTGG + Intergenic
1167360788 19:49029308-49029330 ACCACTTTGGGAGGCCCAGGCGG - Intronic
1167362860 19:49039500-49039522 ACCACTTTGGGAGGCCCAGGCGG + Intergenic
1167475685 19:49699705-49699727 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1167675521 19:50882368-50882390 CCCACCCTGGGAGGCTCCAGAGG + Intergenic
1167728578 19:51235909-51235931 AGCACCTTTGGAGGCCAAGGCGG + Intronic
1167998418 19:53425557-53425579 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1168043760 19:53779358-53779380 AGCACATTTGGAGGCCAAAGCGG - Intergenic
1168089351 19:54071943-54071965 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1168270005 19:55244632-55244654 AGCACTTTCGGAGGCCACAGTGG + Intronic
1168679494 19:58304230-58304252 AGCACTTTGGGAGGCCACAGTGG - Intronic
925492424 2:4410012-4410034 AGCACCTTGGGAGGCCGAAGCGG - Intergenic
925934407 2:8741318-8741340 AACACTTTGGGAGGCCACAGTGG + Intronic
926028315 2:9563979-9564001 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
926622203 2:15057075-15057097 ACCACTTTGGGAGGCCCAGGGGG - Intergenic
927261420 2:21095092-21095114 AGCACCTTGGGAGGCCGGAGGGG - Intergenic
927499179 2:23570886-23570908 ACCAGCTTGGGATGCTCCAGAGG - Intronic
927500995 2:23583103-23583125 ACCCCCTCTGGATGCTCCAGGGG - Intronic
927589351 2:24339777-24339799 AGCACTTTGGGAGGCCACAGTGG + Intronic
927928437 2:27028529-27028551 AGCACTTTTGGAGGCCAAAGCGG + Intergenic
928046860 2:27943036-27943058 AACACTTTGGGAGGCCACAGTGG - Intronic
928554282 2:32407196-32407218 AGCACTTTGGGAGGCCACAGCGG + Intronic
928847988 2:35703807-35703829 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
928959258 2:36906676-36906698 AGCACCTTGGGAGGCCGAAGCGG + Intronic
929129739 2:38555314-38555336 AGCACTTTTGGAGGCCAAAGTGG - Intergenic
929169085 2:38913525-38913547 ACCACTTTGGGAGGCCAAAGTGG + Intronic
929349337 2:40929440-40929462 ACCACTTTGGGAGGCCAAAGCGG - Intergenic
930037716 2:47097868-47097890 AGCACTTTTGGAGGCCCACGTGG + Intronic
930167737 2:48219741-48219763 ACCAGCTTATGAGGCCCCATAGG - Intergenic
930406999 2:50971335-50971357 AGCACTTTGGGAGGCCACAGTGG + Intronic
930553759 2:52869533-52869555 AGCACTTTGGGAGGCCCAAGAGG - Intergenic
930672151 2:54162716-54162738 AGCACTTTTGGAGGCCAGAGGGG + Intronic
930758298 2:55002304-55002326 AGCACTTTGGGAGGCCACAGTGG - Intronic
931341804 2:61408970-61408992 ACCACTTTGGGAGGCCAAAGTGG + Intronic
931356884 2:61544959-61544981 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
931561368 2:63565021-63565043 AGCACCTTTGGAGGCCAAGGCGG - Intronic
931739705 2:65230656-65230678 AGCACTTTAGGAGGCCGCAGTGG - Intronic
931794747 2:65698646-65698668 AGCACCTTGGGAGGCCCAGGTGG - Intergenic
932059819 2:68484747-68484769 AGCACCTTGGGAGGCCCAGGTGG + Intronic
932505374 2:72225097-72225119 AGCACTTTGGGAGGCCACAGTGG - Intronic
932788351 2:74629503-74629525 AGCACTTTGGGAGGCCCAAGTGG + Intronic
932799375 2:74726355-74726377 AGCACTTTTGGAGGCCCAGGTGG - Intergenic
933370363 2:81407718-81407740 AGCACTTTGGGAGGCCCCGGTGG + Intergenic
933717702 2:85373591-85373613 AGCACCTTGGGAGGCCACGGCGG + Intronic
933809567 2:86024640-86024662 AGCACTTTGGGAGGCCACAGTGG + Exonic
933830384 2:86202931-86202953 AACACTTTGGGAGGCCCCGGCGG - Intronic
934069805 2:88373595-88373617 AGCACCTTTGGAGGCCGAGGCGG + Intergenic
934532819 2:95106186-95106208 ACCACCTTATGAGACCTCAGTGG + Intronic
934621226 2:95809010-95809032 AGCACTTTTGGAGGCCAAAGTGG + Intergenic
934880050 2:97968833-97968855 AGCACCTTGGGAGGCCAAAGTGG + Intronic
935250290 2:101254631-101254653 AGCACTTTTGGAGGCCGAAGTGG + Intronic
935290708 2:101608591-101608613 AGCACTTTGGGAGGCCACAGTGG - Intergenic
935546069 2:104400509-104400531 ACCACTTTGGGAGGCCGAAGTGG - Intergenic
935591814 2:104852141-104852163 GCAACCTTTGGGGGCCGCAGAGG + Intergenic
935760289 2:106313899-106313921 AACACTTTGGGAGGCCCAAGCGG - Intergenic
935769400 2:106402569-106402591 AGCACCTTGGGAGGCCAAAGCGG - Intronic
935910695 2:107893354-107893376 AGCACCTTGGGAGGCCAAAGCGG + Intergenic
935968811 2:108510210-108510232 AGCACCTTGGGAGGCCAAAGCGG + Intergenic
936132492 2:109858486-109858508 AGCACCTTGGGAGGCCAAAGCGG + Intergenic
936212205 2:110512999-110513021 AGCACCTTGGGAGGCCAAAGCGG - Intergenic
936254745 2:110902220-110902242 ACCACTTTGGGAGGCCCAGGTGG + Intronic
936289382 2:111208385-111208407 ATCACCTTTGTAGCCACCAGTGG - Intergenic
936421345 2:112367566-112367588 AGCACCTTGGGAGGCCAAAGCGG - Intergenic
936448569 2:112616259-112616281 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
936549260 2:113421174-113421196 AGCACTTTGGGAGGCCACAGAGG + Intergenic
936574191 2:113639904-113639926 AGCACCTTTAGAGGCCCAGGTGG + Intronic
937068361 2:119038225-119038247 ACCACTTTTGGAGGCCGAGGTGG - Intergenic
937109404 2:119351501-119351523 AGCACTTTTGGAGGCCCAGGCGG + Intronic
937110657 2:119364829-119364851 ACCACGTTAGGAGGCCAAAGTGG + Intronic
937573025 2:123386920-123386942 AGCACCTTTGGAGGCCGAGGTGG + Intergenic
937700670 2:124860102-124860124 AGCACCTTGGGAGGCCAAAGTGG + Intronic
937801523 2:126086197-126086219 ACCACTTTGGGAGGCCGCGGTGG + Intergenic
938077212 2:128346226-128346248 AACAGCCTGGGAGGCCCCAGGGG + Intergenic
938609533 2:132933170-132933192 AGCACTTTGGGAGGCCGCAGCGG - Intronic
938640104 2:133268715-133268737 AGCACTTTTGGAGGCCGCGGCGG - Intronic
938865221 2:135411749-135411771 CCCCCTTTTGGAGTCCCCAGTGG - Intronic
939171974 2:138706662-138706684 AGCACTTTTGGAGGCCAAAGCGG + Intronic
939768270 2:146281051-146281073 AGCACCTTGGGAGGCCAAAGTGG - Intergenic
940209139 2:151238449-151238471 AGCACTTTGGGAGGCCACAGTGG - Intergenic
941818596 2:169823570-169823592 AGCACTTCTTGAGGCCCCAGTGG + Intronic
941981748 2:171465730-171465752 AGCACCTTGGGAGGCCAAAGTGG - Intronic
942037999 2:172030001-172030023 AGCACCTTGGGAGGCCCAGGCGG - Intronic
942350323 2:175045972-175045994 AGCACTTTGGGAGGCCACAGTGG - Intergenic
943389268 2:187243266-187243288 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
944652943 2:201850068-201850090 ACCACTTTGGGAGGCCAAAGCGG - Intronic
944954993 2:204798534-204798556 GCCACCTACGGAGGCACCAGAGG + Intronic
946745769 2:222844092-222844114 ACCAAGTTTAGAGGCCACAGTGG - Intergenic
947219533 2:227779254-227779276 AGCACTTTTGGAGGCCGAAGTGG + Intergenic
947512947 2:230775479-230775501 AGCACTTTGGGAGGCCACAGTGG - Intronic
948039296 2:234886757-234886779 AGCACTTTTGGAGGCCAAAGTGG - Intergenic
948723674 2:239919077-239919099 ACCATCTTGGGAGGCAGCAGAGG + Intronic
948903941 2:240969001-240969023 AGCTCCCTTGCAGGCCCCAGGGG + Intronic
948981490 2:241497032-241497054 AGCCCATGTGGAGGCCCCAGCGG - Intronic
949020877 2:241740697-241740719 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1168963255 20:1883122-1883144 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1169114530 20:3055008-3055030 AACACTTTGGGAGGCCACAGTGG - Intergenic
1169139537 20:3219359-3219381 AGCACTTTGCGAGGCCCCAGCGG + Intronic
1169271133 20:4200248-4200270 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1169300576 20:4438821-4438843 ACCATCCTTGGATGCCCCATGGG - Intergenic
1169786605 20:9366140-9366162 AGCACTTTGGGAGGCCGCAGCGG + Intronic
1170137396 20:13089536-13089558 AGCACTTTGGGAGGCCACAGCGG + Intronic
1170509051 20:17058163-17058185 AGCACTTTTGGAGGCCCAGGTGG + Intergenic
1170799007 20:19575000-19575022 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1171170822 20:23014022-23014044 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1171983990 20:31646655-31646677 AGCACTTTGGGAGGCCGCAGCGG + Intergenic
1172128590 20:32640442-32640464 ACCACTTTGGGAGGCCAAAGTGG + Intergenic
1173493106 20:43499466-43499488 AACACTTTGGGAGGCCCAAGGGG - Intergenic
1173972874 20:47165940-47165962 ACCACTTTGGGAGGCCACAGCGG + Intronic
1174393756 20:50233710-50233732 GCCACCTTGGGAGGCCCCTGAGG - Intergenic
1174697216 20:52572356-52572378 AGCACTTTTGGAGGCCCAGGCGG - Intergenic
1174799231 20:53549208-53549230 AGCACCTTGGGAGGCCGAAGAGG + Intergenic
1175216681 20:57394966-57394988 CCCACCTCTGCAGGCCCCAGAGG - Intronic
1175263298 20:57688126-57688148 ACCAGCTTTGAATTCCCCAGGGG + Intronic
1175424062 20:58853349-58853371 ACCACCTTTGGAGGCCCCAGGGG + Exonic
1175894386 20:62329601-62329623 TCCACCTTGTGAGGCTCCAGAGG - Intronic
1176669513 21:9719497-9719519 AGCACTTTTGGAGGCCCAGGCGG - Intergenic
1177152730 21:17470775-17470797 AGCACCTTTGGAGGCCGAGGCGG + Intergenic
1177587460 21:23117138-23117160 ATTACCTTTGGAGGCTCTAGGGG - Intergenic
1177918145 21:27116459-27116481 ACCACTTTGGGAGGCCGAAGCGG - Intergenic
1178209266 21:30509656-30509678 AGCACTTTTGGAGGCCGAAGTGG + Intergenic
1178391062 21:32198690-32198712 AAAGGCTTTGGAGGCCCCAGAGG + Intergenic
1178933364 21:36838864-36838886 ACTCCCTCTGGAGGCTCCAGGGG - Intronic
1178954807 21:37012486-37012508 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1178956418 21:37026383-37026405 AACACTTTGGGAGGCCACAGAGG - Intergenic
1179419054 21:41221576-41221598 AGCACTTTGGGAGGCCGCAGAGG + Intronic
1179507687 21:41852686-41852708 GCCACCGCTGCAGGCCCCAGAGG + Intronic
1179541743 21:42087379-42087401 ACCTCCTTTGGAGTTCCCAGTGG + Intronic
1179640844 21:42746391-42746413 GCCACCTCTGAAGGCCCCAGGGG + Intronic
1179673068 21:42963199-42963221 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1179951481 21:44711139-44711161 AGCACTTGTGGAGGCCCCGGTGG + Intronic
1180355179 22:11833716-11833738 AGCACTTTTGGAGGCCGAAGTGG + Intergenic
1180669999 22:17545595-17545617 AGCACTTTGGGAGGCCACAGTGG + Intronic
1180679979 22:17618750-17618772 AGCACTTTGGGAGGCCCAAGCGG + Intronic
1181476530 22:23171211-23171233 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1182376476 22:29852265-29852287 AGCACTTTTGGAGGCCCATGTGG - Intergenic
1182869897 22:33636777-33636799 AGCACCTTAGGAGGCCGAAGTGG - Intronic
1183506841 22:38214139-38214161 AGCACCTTTGAATGCCCCAGGGG - Intronic
1183774375 22:39953858-39953880 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1183970034 22:41469657-41469679 ACCACCTTTTGAGGACCCTGCGG + Intronic
1184052066 22:42014472-42014494 AGCACTTTGGGAGGCCACAGTGG - Intronic
1184346466 22:43916646-43916668 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1184927161 22:47650956-47650978 ACCACCTGTGTAGGCCACACTGG - Intergenic
1185059163 22:48597162-48597184 ACCACCATTGATGGTCCCAGAGG + Intronic
1185126028 22:49011286-49011308 TCCACCGTGGCAGGCCCCAGAGG - Intergenic
1185212140 22:49576325-49576347 GCCACCTGTGGGAGCCCCAGGGG + Intronic
1185425982 22:50770987-50771009 AGCACCTTTAGAGGCCCAGGTGG - Intronic
949142062 3:646184-646206 AACACTTTGGGAGGCCCCAGCGG + Intergenic
949345838 3:3075845-3075867 AGCACTTTGGGAGGCCACAGCGG - Intronic
949707485 3:6835750-6835772 AGCACTTTGGGAGGCCTCAGTGG + Intronic
950488634 3:13288528-13288550 ACCACTTTTGGAGGCCGAGGCGG + Intergenic
950618790 3:14185101-14185123 ACCACTTTGGGAGGCCAAAGCGG + Intronic
951222742 3:20086021-20086043 AGCACTTTGGGAGGCCACAGTGG + Intronic
951343777 3:21521503-21521525 AGCACTTTGGGAGGCCACAGTGG + Intronic
951518198 3:23585126-23585148 ACCACTTTTGGAGGCCAAGGTGG + Intronic
951853224 3:27166710-27166732 ACCACTTTGGGAGGCCCAGGGGG + Intronic
952375882 3:32766876-32766898 ACCACCATTGGCAGCCCCAGAGG + Intronic
952794487 3:37226888-37226910 AGCACTTTTGGAGGCCCAGGTGG + Intergenic
953044836 3:39285124-39285146 AGCACCTTGGGAGGCCAAAGTGG + Intergenic
953314331 3:41912078-41912100 AACACTTTGGGAGGCCACAGCGG + Intronic
953398097 3:42589015-42589037 AGCACTTTTGGAGGCCGAAGCGG + Intronic
953653284 3:44825148-44825170 ACAACCATTGAAGGCCACAGTGG - Intronic
953805823 3:46066488-46066510 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
954201341 3:49025121-49025143 CTCACCTGTGGAGGCCCCAAGGG + Exonic
954246743 3:49338410-49338432 AGCACTTTGGGAGGCCACAGCGG + Intronic
954312518 3:49781308-49781330 AGCACTTTGGGAGGCCACAGCGG - Intronic
954322005 3:49838636-49838658 AGCACTTTGGGAGGCCCAAGTGG + Intronic
954355510 3:50081377-50081399 AGCACTTTGGGAGGCCCAAGCGG + Intronic
954615500 3:51967167-51967189 CCCACCTGTGCAGGCCTCAGCGG + Intronic
954677774 3:52325214-52325236 ACCACCTCTGGTGGCCTCTGTGG + Intronic
955290054 3:57683905-57683927 AGCACTTTGGGAGGCCGCAGCGG + Intronic
955899779 3:63740175-63740197 ATGACCTTTGGAGGCTCTAGGGG - Intergenic
956089008 3:65643993-65644015 ATCATCTTTGGAGACCCCAGAGG + Intronic
956671198 3:71692704-71692726 AGCAACTTTGGAGGCTGCAGTGG - Intronic
957350885 3:79020442-79020464 AGCACTTTGGGAGGCCCAAGCGG + Intronic
958764834 3:98354287-98354309 TCCAGCTTTGAAGGCCCCTGTGG - Exonic
958887860 3:99748225-99748247 GCCACCATTGGAGGTGCCAGAGG - Intronic
960171076 3:114461551-114461573 AGCACTTTAGGAGGCCCAAGTGG - Intronic
960287358 3:115844727-115844749 AGCACTTTGGGAGGCCCAAGTGG + Intronic
960649532 3:119931366-119931388 AGCACCTTGGGAGGCCGAAGTGG + Intronic
960724318 3:120654823-120654845 AGCACCTTTGGAGGCCAAGGTGG + Intronic
960809970 3:121618641-121618663 AACACTTTGGGAGGCCCAAGCGG - Intronic
960872804 3:122266755-122266777 AACACTTTGGGAGGCCACAGTGG + Intronic
960920629 3:122743898-122743920 AGCACTTTTGGAGGCCAAAGTGG + Intronic
961103287 3:124220188-124220210 AGCACTTTGGGAGGCCCAAGTGG - Intronic
961257508 3:125569194-125569216 AGCACTTTGGGAGGCCACAGTGG - Intronic
961518117 3:127451053-127451075 ACCACCTTTGGTGGCCCTGGTGG - Intergenic
962202271 3:133411207-133411229 ATCACCTTTGGAGCCCACTGAGG + Intronic
962258214 3:133886485-133886507 AGCAGGTTTGGTGGCCCCAGAGG + Intronic
962352986 3:134669273-134669295 AGCACCTTTGGAGGCCGAGGTGG - Intronic
962783109 3:138740108-138740130 AGCACCTTGGGAGGCCAAAGCGG + Intronic
963161067 3:142150531-142150553 ACCACTTTGGGAGGCCCAGGCGG - Intergenic
963529973 3:146462710-146462732 AGCACTTTGGGAGGCCGCAGTGG - Intronic
964023489 3:152042990-152043012 ACCACTTTGGGAGGCCAAAGTGG + Intergenic
964108903 3:153068847-153068869 AGCACTTTGGGAGGCCACAGTGG + Intergenic
964305677 3:155336911-155336933 AGCACTTTGGGAGGCCTCAGTGG + Intergenic
965019635 3:163212589-163212611 ACCACATTGGGAGGCCGAAGTGG - Intergenic
965107702 3:164379389-164379411 ACCACTTTGGGAGGCCAAAGCGG + Intergenic
966436068 3:179885397-179885419 AGCACCTTGGGAGGCCAAAGTGG + Intronic
966710429 3:182966857-182966879 AGCACCTTGGGAGGCCCAGGCGG + Intronic
966841093 3:184088316-184088338 AGCACTTTGGGAGGCCACAGTGG + Intergenic
966890330 3:184402920-184402942 AGCACCTTGGGAGGCCACAGCGG - Intronic
966939544 3:184736894-184736916 ACCACTTTGGGAGGCCGAAGGGG - Intergenic
967019511 3:185510194-185510216 AGCACCTTGGGAGGCCAAAGTGG - Intronic
967933777 3:194710078-194710100 ACCACTTTGGGAGGCCGAAGCGG - Intergenic
968024997 3:195434174-195434196 AGCACTTTGGGAGGCCACAGTGG - Intronic
968033951 3:195529115-195529137 AGCACCTTGGGAGGCCAAAGTGG - Intronic
968074357 3:195808451-195808473 AGCACTTTTGGAGGCCCAGGCGG - Intronic
968190577 3:196664386-196664408 AACACTTTGGGAGGCCACAGTGG - Intronic
968395613 4:233947-233969 AGCACTTTGGGAGGCCACAGAGG + Intergenic
968894265 4:3389623-3389645 TCCACCTGTGGAGGCTGCAGTGG - Intronic
969488739 4:7486683-7486705 TCCTCCTTTGGAGGCTCCAGGGG - Intronic
969829335 4:9782132-9782154 ACCACCTGTGAGGGCCCCAGTGG - Exonic
970061327 4:12037826-12037848 AGCACTTTGGGAGGCCTCAGGGG - Intergenic
970397136 4:15680421-15680443 AGCACTTTGGGAGGCCCAAGTGG + Intronic
970581124 4:17474947-17474969 AGCACCTTGGGAGGCCAAAGTGG - Intronic
970583918 4:17496994-17497016 AGCACTTTGGGAGGCCACAGCGG - Intronic
970758620 4:19455977-19455999 AGCACTTTGGGAGGCCCCGGGGG - Intergenic
972186029 4:36529526-36529548 ACCAACCTTGAAGCCCCCAGTGG + Intergenic
972271316 4:37512839-37512861 AGCACCTTGGGAGGCCGAAGGGG + Intronic
972416011 4:38841341-38841363 AGCACTTTGGGAGGCCACAGCGG + Intronic
972481244 4:39498457-39498479 ACCACTTTGGGAGGCCAAAGAGG - Intergenic
972523604 4:39885665-39885687 AACACTTTTGGAGGCCGAAGTGG + Intronic
972545744 4:40078773-40078795 AGCACTTTGGGAGGCCACAGTGG - Intronic
972847647 4:43009083-43009105 GCCTTCTTTGGAGGCCACAGAGG + Intronic
972942872 4:44218379-44218401 ACCACTTTGGGAGGCCAAAGCGG - Intronic
972948106 4:44283295-44283317 AGCACTTTGGGAGGCCACAGTGG - Intronic
974045193 4:56892606-56892628 ACCACTTTGGGAGGCCGAAGCGG - Intergenic
974102905 4:57437275-57437297 AGCACCTTGGGAGGCCGAAGAGG + Intergenic
974555289 4:63438575-63438597 AGCACTTTTGGAGGCCAAAGTGG - Intergenic
974783244 4:66582758-66582780 AGCACTTTGGGAGGCCGCAGCGG - Intergenic
975460234 4:74643850-74643872 AGCACTTTGGGAGGCCACAGTGG + Intergenic
975646628 4:76552257-76552279 ACCACTTTGGGAGGCCAAAGTGG + Intronic
975665123 4:76727640-76727662 AGCACCTTGGGAGGCCAAAGTGG + Intronic
976223961 4:82780801-82780823 GCCACCCCAGGAGGCCCCAGGGG + Intronic
976301614 4:83520987-83521009 AGCACCTTGGGAGGCCGAAGAGG - Intronic
976843952 4:89465227-89465249 AGCACTTTGGGAGGCCACAGTGG + Intergenic
977799110 4:101204387-101204409 AGCACTTTGGGAGGCCCAAGCGG + Intronic
977806890 4:101310430-101310452 ATCACTTTGGGAGGCCCAAGTGG + Intronic
978044690 4:104112077-104112099 ACCACTTTGGGAGGCTGCAGAGG - Intergenic
979734482 4:124065532-124065554 ACAACAGTTTGAGGCCCCAGAGG + Intergenic
979947091 4:126845674-126845696 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
980125947 4:128774364-128774386 AGCACTTTGGGAGGCCCAAGGGG - Intergenic
980949457 4:139358867-139358889 AGCACTTTTGGAGGCCAAAGTGG + Intronic
981464625 4:145054152-145054174 AGCACTTTGGGAGGCCGCAGCGG - Intronic
981541409 4:145850255-145850277 AGCACTTTTGGAGGCCGAAGTGG - Intronic
981773485 4:148337040-148337062 AGCACTTTGGGAGGCCACAGTGG - Intronic
981961062 4:150539219-150539241 AGCACTTTGGGAGGCCGCAGCGG - Intronic
982243010 4:153319479-153319501 AGCACCTTGGGAGGCCGCAGCGG + Intronic
982294649 4:153814672-153814694 AGCACCTTGGGAGGCCAAAGAGG - Intergenic
982365038 4:154568596-154568618 AGCACCTTGGGAGGCCAAAGTGG + Intronic
982924172 4:161315274-161315296 AGCACTTTGGGAGGCCACAGCGG + Intergenic
983170289 4:164528420-164528442 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
983225977 4:165086670-165086692 AGCACTTTGGGAGGCCTCAGCGG - Intronic
983544115 4:168944195-168944217 ACCACTTTGGGAGGCCGAAGTGG + Intronic
984931258 4:184849143-184849165 ACCTTCTTCCGAGGCCCCAGAGG + Intergenic
984970861 4:185188589-185188611 AGCACCTTTGGAGGCCAAGGTGG - Intronic
985040653 4:185888455-185888477 ACTCCCTCTGGAGGCCCTAGGGG - Intronic
985405258 4:189631969-189631991 AGCACTTTTGGAGGCCCAGGCGG + Intergenic
985432182 4:189892161-189892183 AGCACTTTTGGAGGCCAAAGCGG - Intergenic
986183982 5:5419433-5419455 TCCACCCTAGGATGCCCCAGAGG + Intergenic
986337601 5:6766900-6766922 ACCTGCCTTGGAAGCCCCAGGGG + Intergenic
986704570 5:10444536-10444558 AGCACTTTGGGAGGCCCAAGTGG - Intronic
986904594 5:12479888-12479910 ACCACTTTGGGAGGCCAAAGTGG - Intergenic
987222424 5:15804218-15804240 AACACTTTGGGAGGCCCAAGAGG + Intronic
987780615 5:22429384-22429406 AGCACTTTGGGAGGCCCAAGTGG - Intronic
987827453 5:23051088-23051110 AGCACTTTGGGAGGCCCAAGCGG - Intergenic
988130995 5:27106265-27106287 AGCACTTTGGGAGGCCCCGGCGG + Intronic
988159882 5:27505160-27505182 ACCACTTTGGGAGGCCTAAGTGG + Intergenic
988413577 5:30917024-30917046 ATCATCTTTGGATGCCTCAGTGG + Intergenic
988458031 5:31405117-31405139 AGCACTTTTGGAGGCCCAGGTGG + Intronic
988485206 5:31662875-31662897 AGCACTTTGGGAGGCCACAGCGG - Intronic
988569409 5:32349441-32349463 AACACTTTGGGAGGCCCCAGTGG - Intergenic
988679590 5:33471961-33471983 AGCACCTTGGGAGGCCACGGTGG + Intergenic
989050530 5:37315693-37315715 ACCACTTTGGGAGGCCGAAGTGG + Intronic
989082390 5:37637092-37637114 ACCACTTTGGGAGGCCGAAGTGG + Intronic
989138260 5:38176621-38176643 AGCACTTTGGGAGGCCACAGCGG + Intergenic
989603554 5:43222479-43222501 AGCACTTTGGGAGGCCGCAGTGG + Intronic
990412735 5:55557235-55557257 AGCACCTTCGGAGGCCACGGTGG - Intergenic
990508194 5:56465793-56465815 ACCATATGTGCAGGCCCCAGGGG + Intronic
991065872 5:62424384-62424406 AGCACTTTGGGAGGCCCCGGCGG - Intronic
991476700 5:67028879-67028901 AGCACATTAGGAGGCCCAAGTGG + Intronic
991599137 5:68335153-68335175 AACACATTTGGTTGCCCCAGAGG - Intergenic
992258948 5:74950858-74950880 AGCAGTTTGGGAGGCCCCAGTGG - Intergenic
992539174 5:77744781-77744803 AGCACTTTTGGAGGCCGAAGCGG - Intronic
992692752 5:79256649-79256671 ACCACTTTTGGAGGCCAAAAAGG - Intronic
992890661 5:81201106-81201128 ACCCCCTGGGGAGCCCCCAGGGG + Intronic
993510013 5:88759233-88759255 AGCACCTTGGGAGGCCCAGGCGG + Intronic
993670817 5:90759716-90759738 AGCACTTTGGGAGGCCGCAGCGG + Intronic
993693294 5:91028981-91029003 ACCACTTTTGGAAGCCCAGGTGG - Intronic
994740372 5:103610473-103610495 ACCACCTTGGGAGGCCGAAGCGG + Intergenic
995376390 5:111479124-111479146 AGCACTTTGGGAGGCCACAGTGG - Intronic
995903905 5:117100636-117100658 AGCACTTTGGGAGGCCGCAGTGG + Intergenic
996115044 5:119608978-119609000 ACCCCCAGTGGAGTCCCCAGGGG + Intronic
996756670 5:126943328-126943350 AGCACCTTGGGAGGCCAAAGTGG + Intronic
996779238 5:127167088-127167110 ACTGCCTATGGAGGCTCCAGGGG + Intergenic
996945222 5:129058670-129058692 AGCACTTTGGGAGGCCACAGTGG + Intergenic
997267623 5:132504820-132504842 AGCATCTTTGGAGGCCAAAGTGG - Intergenic
997297643 5:132777641-132777663 AGCACATTTGCAGGCTCCAGCGG - Intronic
997480992 5:134184421-134184443 GCAACCTTTGGAGGGGCCAGAGG - Intronic
998082952 5:139292207-139292229 ACCACTTTTGGAGGCCTTGGCGG - Intronic
998237164 5:140407927-140407949 ACCACTTTGGGAGGCCAAAGCGG + Intronic
998496127 5:142590980-142591002 ACCAGCCTTGGAGGCAGCAGTGG + Intergenic
998777869 5:145623201-145623223 AGCACTTTGGGAGGCCACAGTGG + Intronic
998968184 5:147563262-147563284 AGCACTTTGGGAGGCCCGAGTGG - Intergenic
998970936 5:147591968-147591990 ATCACCTTGGAAGGCCTCAGAGG - Intronic
999554530 5:152725816-152725838 ACTAACTTTGGATGTCCCAGAGG + Intergenic
1000778883 5:165454627-165454649 AACACTTTGGGAGGCCCAAGTGG + Intergenic
1001294627 5:170490248-170490270 TCCAACTTTGGATGTCCCAGAGG - Intronic
1001517618 5:172366877-172366899 AGCACTTTGGGAGGCCACAGCGG - Intronic
1001791736 5:174463580-174463602 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1001904550 5:175460988-175461010 ACCACTTTGGGAGGCCCAGGTGG + Intergenic
1002138188 5:177121508-177121530 AACACTTTGGGAGGCCCAAGTGG - Intergenic
1002384676 5:178857492-178857514 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1002628087 5:180547270-180547292 AGCACTTTGGGAGGCCACAGTGG + Intronic
1002744475 5:181459630-181459652 AGTACCTTTGGAGGCCCAGGTGG + Intergenic
1003298226 6:4853034-4853056 AGCACTTTGGGAGGCCCAAGAGG - Intronic
1003550350 6:7097705-7097727 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1003672863 6:8175728-8175750 AACACTTTGGGAGGCCACAGTGG - Intergenic
1004434355 6:15576368-15576390 AGCACTTTGGGAGGCCACAGCGG - Intronic
1004676085 6:17843795-17843817 ACCACTTTTGGAGGCCGAGGGGG + Intronic
1005125684 6:22443841-22443863 AGCACTTTGGGAGGCCCAAGAGG + Intergenic
1005488679 6:26325482-26325504 AGCACCTATGGAGGACTCAGAGG + Intergenic
1006201369 6:32295086-32295108 AGCACCTTGGGAGGCCAAAGTGG + Intronic
1006313129 6:33275564-33275586 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1007236157 6:40392505-40392527 ACCACCTTCGGCGGGCCCTGCGG + Exonic
1007552204 6:42738696-42738718 AGCACCTTTGGAGGCTGGAGTGG + Intergenic
1008102257 6:47404581-47404603 AGCACCTTTGGAGGCCGAAGTGG - Intergenic
1008121047 6:47617210-47617232 ACCACTTTGGGAGGCCAAAGTGG - Intronic
1008704929 6:54145887-54145909 ACCAAGTTGGGAGACCCCAGTGG + Intronic
1008921646 6:56849380-56849402 AGCACTTTGGGAGGCCCCCGTGG - Intronic
1008923387 6:56866243-56866265 AGCACTTTGGGAGGCCCCAGTGG - Intronic
1009858379 6:69293090-69293112 CCAACATTTGCAGGCCCCAGGGG + Intronic
1010430911 6:75777682-75777704 AGCACTTTGGGAGGCCACAGGGG - Intronic
1011037169 6:82990523-82990545 AGCACTTTGGGAGGCCACAGTGG - Intronic
1011367107 6:86595066-86595088 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1011724050 6:90190188-90190210 ACCACTTTGGGAGGCCCAGGAGG - Intronic
1012889240 6:104879996-104880018 AGCACTTTGGGAGGCCACAGAGG - Intergenic
1013251960 6:108343293-108343315 AACACTTTGGGAGGCCCCAGTGG - Intronic
1014121789 6:117734358-117734380 AACACTTTGGGAGGCCGCAGCGG - Intergenic
1015761543 6:136667470-136667492 AGCACCTTGGGAGGCCCAGGTGG + Intronic
1016472424 6:144388747-144388769 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1016807700 6:148228886-148228908 AGCACCTTTGGAGGCCGAGGCGG + Intergenic
1017260040 6:152375188-152375210 AGCACTTTAGGAGGCCACAGTGG - Intronic
1017988303 6:159463924-159463946 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1018679933 6:166255866-166255888 AACACTTTTGGAGGCCCAGGCGG + Intergenic
1019169980 6:170128419-170128441 AACACTTTGGGAGGCCACAGCGG + Intergenic
1019249386 6:170733171-170733193 AGTACCTTTGGAGGCCCAGGTGG + Intergenic
1019968645 7:4522470-4522492 AGCACTTTGGGAGGCCGCAGCGG + Intergenic
1020026112 7:4901191-4901213 ACCACCTTGGGAGGCCAAGGTGG + Intergenic
1020781708 7:12524595-12524617 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1021125096 7:16842769-16842791 AACACTTTGGGAGGCCACAGGGG - Intergenic
1021444230 7:20715655-20715677 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1022273312 7:28831615-28831637 AACACTTTAGGAGGCCACAGCGG - Intergenic
1022398677 7:30015164-30015186 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1022483367 7:30758890-30758912 AGCACCTTGGGAGGCCGAAGAGG - Intronic
1023776018 7:43608032-43608054 AACACCTTTGGAGGCCAAGGTGG + Intronic
1023813698 7:43931933-43931955 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1023816937 7:43958359-43958381 ACCACTTTGGGAGGCCACGGTGG + Intergenic
1023977812 7:45044381-45044403 AGCACCTTTGGAGGCCGAGGCGG - Intronic
1024026123 7:45411220-45411242 ACCACCCCTGGAGCCTCCAGAGG - Intergenic
1024180407 7:46887566-46887588 ACCACTTTGGGAGGCCACAGTGG + Intergenic
1024560312 7:50639426-50639448 AGCACCTTGGGAGGCCGAAGTGG + Intronic
1024932685 7:54680394-54680416 ACCACCTTCTGTGTCCCCAGAGG + Intergenic
1025049547 7:55722880-55722902 ACCAACTTTGAGGGCCCCAAAGG - Intergenic
1025056977 7:55772887-55772909 AGCACCTTGGGAGGCCGAAGTGG + Intergenic
1026048487 7:66924650-66924672 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1026828681 7:73598870-73598892 ACCACCTTGGGAGGCCGAGGCGG + Intronic
1026852236 7:73732134-73732156 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1027218226 7:76197800-76197822 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1027327783 7:77061878-77061900 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1027888892 7:83945674-83945696 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1028188037 7:87812359-87812381 AGCACTTTGGGAGGCCACAGCGG + Intronic
1028557227 7:92137066-92137088 ACCACTTTGGGAGGCCCTGGTGG + Intronic
1028925756 7:96355404-96355426 AGCACCTTTGGAGGCCAAGGGGG + Intergenic
1029223413 7:99008069-99008091 AGCACTTTGGGAGGCCACAGTGG - Intronic
1029579696 7:101427412-101427434 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1029632014 7:101758452-101758474 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1029641643 7:101824334-101824356 ACCACTTTGGGAGGCCGAAGGGG - Intronic
1029696371 7:102216054-102216076 AGCACTTTGGGAGGCCGCAGCGG + Intronic
1029798882 7:102925144-102925166 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1029802500 7:102964061-102964083 AGCACCTTGGGAGGCCAAAGCGG + Intronic
1029826836 7:103206159-103206181 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1029900731 7:104036488-104036510 AACACCTTGGGAGGCCAAAGTGG - Intergenic
1030111269 7:106029226-106029248 AGCACTTTGGGAGGCCACAGTGG - Intronic
1030191843 7:106818153-106818175 ACCACCTTGGGAGGCCGAGGCGG + Intergenic
1030678453 7:112409034-112409056 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1032067094 7:128779635-128779657 ACCACTTTTGGAGGCCAAGGTGG + Intergenic
1032134919 7:129267550-129267572 AGCACCTTTGGAGGCCAAGGTGG - Intronic
1032243924 7:130190747-130190769 AGCACTTTTGGAGGCCAAAGTGG + Intronic
1032787856 7:135214989-135215011 AGCACTTTGGGAGGCCCAAGTGG + Intergenic
1032820892 7:135523551-135523573 AGCACCTTTGGAGGCCAAGGTGG + Intergenic
1032997540 7:137464502-137464524 ACCACCTTTGGGGCTCCCAGGGG + Intronic
1033663640 7:143421342-143421364 ACCACTTTGGGAGGCCAAAGCGG - Intergenic
1034253339 7:149710118-149710140 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1034420061 7:150985870-150985892 AGCACCTTGGGAGGCCCAGGTGG - Intergenic
1034640730 7:152600338-152600360 ACCACCTTGGGAGGCCAAGGTGG - Intergenic
1035277183 7:157754595-157754617 ACCACCTTTGGAGGAGGCCGAGG + Intronic
1035423229 7:158747096-158747118 AGCACGTTGGGAGGCCACAGTGG + Intronic
1035498711 8:74476-74498 AGTACCTTTGGAGGCCCAGGTGG - Intronic
1036142198 8:6218779-6218801 AGCACCTTGGGAGGCCACGGCGG + Intergenic
1036195646 8:6711713-6711735 ACTCCCTCTGGAGGCCCTAGGGG + Intronic
1036765445 8:11546959-11546981 ACCCTCTTGGGAGTCCCCAGGGG - Intronic
1036953886 8:13166578-13166600 AGCACTTTGGGAGGCCACAGCGG - Intronic
1037276483 8:17185407-17185429 AGCACCTTGGGAGGCCAAAGCGG + Intronic
1037767068 8:21778639-21778661 AACACTTTTGGAGGCCAAAGTGG + Intronic
1037912224 8:22750345-22750367 AGCACTTTGGGAGGCCACAGCGG - Intronic
1038158653 8:25015575-25015597 AACACTTTGGGAGGCCCAAGTGG + Intergenic
1038545582 8:28423711-28423733 ACCACTTTTGGAGGCCGAGGGGG + Intronic
1038555081 8:28505597-28505619 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1038826049 8:31003512-31003534 AGCACTTTGGGAGGCCACAGTGG + Intronic
1039063773 8:33592321-33592343 AGCACTTTTGGAGGCCGAAGGGG + Intronic
1039605995 8:38881229-38881251 AGCACTTTTGGAGGCCCAGGAGG + Intergenic
1039714992 8:40098661-40098683 AGCACTTTTGGAGGCCGAAGCGG + Intergenic
1039889890 8:41678387-41678409 AGCACTTTTGGAGGCCCAGGTGG - Intronic
1040001711 8:42582636-42582658 AGCACCTTGGGAGGCCCAGGCGG - Intergenic
1040054279 8:43044026-43044048 AGCACCTTGGGAGGCCAAAGTGG - Intronic
1040306010 8:46212211-46212233 GCAATCTTGGGAGGCCCCAGTGG - Intergenic
1040529134 8:48251611-48251633 ACCACTTTGGGAGGCCAAAGTGG - Intergenic
1041417347 8:57626227-57626249 AACACTTTTGGAGGCCAAAGTGG + Intergenic
1041533995 8:58905176-58905198 AGCACTTTTGGAGGCCAAAGCGG - Intronic
1041697091 8:60747323-60747345 AGCACTTTGGGAGGCCACAGCGG - Intronic
1041750568 8:61256265-61256287 AGCACCTTGGGAGGCCGAAGCGG + Intronic
1042227754 8:66527755-66527777 AGCACCTTGGGAGGCCGAAGTGG + Intergenic
1042383956 8:68151441-68151463 GCCACATTTGTAGGCCCCAAGGG + Intronic
1042496362 8:69458637-69458659 AGCACTTTCGGAGGCCCCGGCGG - Intergenic
1042563142 8:70088557-70088579 ACCACCTTAGGAGGTTGCAGGGG + Intergenic
1043434029 8:80221140-80221162 AGCACTTTGGGAGGCCACAGTGG + Intronic
1043494826 8:80789497-80789519 AGCACTTTGGGAGGCCACAGAGG + Intronic
1043889144 8:85637124-85637146 ACCACTTTGGGAGGCCGAAGTGG + Intergenic
1044399722 8:91756973-91756995 AACACTTTGGGAGGCCACAGTGG - Intergenic
1044796099 8:95899326-95899348 AGCACCTTGGGAGGCCACAGTGG + Intergenic
1045058109 8:98386730-98386752 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1045966055 8:108025767-108025789 ACCACCTTGGGAGGCTGAAGTGG - Intronic
1046166858 8:110448571-110448593 AACACCTTTGGAGTCCCAGGTGG + Intergenic
1046167131 8:110451566-110451588 ACCACTTTGGGAGGCCCAGGTGG + Intergenic
1046303882 8:112336155-112336177 AGCACTTTGGGAGGCCACAGTGG - Intronic
1046621618 8:116534499-116534521 AGCACTTTGGGAGGCCTCAGCGG + Intergenic
1046641764 8:116739401-116739423 AGCACTTTTGGAGGCCGCGGCGG + Intronic
1047260710 8:123257164-123257186 AGCACTTTTGGAGGCCAAAGCGG - Intronic
1047275733 8:123403345-123403367 ACCACTTTGGGAGGCCTAAGTGG - Intronic
1047429518 8:124779019-124779041 ACCACCTTGGGAGGCCGAGGCGG + Intergenic
1047963212 8:130025929-130025951 AGCACTTTTGGAGGCCAAAGTGG - Intergenic
1048339525 8:133527925-133527947 ACCACTTTGGGAGGCCAAAGTGG + Intronic
1048895251 8:138986452-138986474 AGCACTTTTGGAGGCCGAAGTGG - Intergenic
1049297255 8:141848771-141848793 ATCACCTCTGGAGGGGCCAGAGG - Intergenic
1049334119 8:142073431-142073453 CCTTCCTTTGGAGGCCCCGGTGG - Intergenic
1049719041 8:144107177-144107199 AGCAGCTGGGGAGGCCCCAGGGG - Exonic
1049770364 8:144377593-144377615 AGCACTTTTGGAGGCCAAAGCGG - Intronic
1049903679 9:195673-195695 AGCACTTTGGGAGGCCACAGAGG - Intergenic
1050082287 9:1927989-1928011 AACACCTGTGGAGGCCCCAGAGG - Intergenic
1050114489 9:2249526-2249548 AGCACTTTGGGAGGCCACAGCGG - Intergenic
1050148774 9:2598472-2598494 AGCACTTTGGGAGGCCCAAGAGG + Intergenic
1051548063 9:18298774-18298796 AGCACTTTGGGAGGCCGCAGCGG + Intergenic
1051634631 9:19170446-19170468 AGCACTTTGGGAGGCCGCAGTGG - Intergenic
1051929495 9:22367562-22367584 ACCACTTTGGGAGGCCAAAGTGG - Intergenic
1052702005 9:31949181-31949203 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1052798098 9:32942418-32942440 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1053080296 9:35170411-35170433 AACACTTTGGGAGGCCGCAGTGG - Intronic
1053548978 9:39055077-39055099 AGCACTTTTGGAGGCCCTGGCGG - Intergenic
1053721351 9:40950219-40950241 AGCACCTTTGGAGGCCGAGGCGG - Intergenic
1053746687 9:41205977-41205999 AGCACTTTGGGAGGCCACAGAGG - Intergenic
1053813096 9:41875148-41875170 AGCACTTTTGGAGGCCCTGGCGG - Intergenic
1054344647 9:63901949-63901971 AGCACCTTTGGAGGCCGAGGTGG + Intergenic
1054617499 9:67312291-67312313 AGCACTTTTGGAGGCCCTGGCGG + Intergenic
1054681659 9:68225305-68225327 AGCACTTTGGGAGGCCACAGAGG + Intergenic
1055150279 9:72989813-72989835 AACACCTTTGGAGGCCGAGGTGG + Intronic
1055322882 9:75099516-75099538 AACACTTTGGGAGGCCCAAGTGG - Intronic
1056065190 9:82926144-82926166 AGGACCTTGGGAGGCCACAGCGG + Intergenic
1056499218 9:87191256-87191278 AACACTTTTGGAGGCCAAAGCGG + Intergenic
1056862922 9:90203706-90203728 AGCACCTTGGGAGGCCAAAGTGG + Intergenic
1057086345 9:92214306-92214328 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1057143591 9:92743440-92743462 AGCACTTTTGGAGGCCAAAGTGG - Intronic
1057406454 9:94775725-94775747 AGCACTTTTGGAGGCCCAGGTGG + Intronic
1057470771 9:95354117-95354139 AACACCTTGGGAGGCCAAAGTGG - Intergenic
1057573079 9:96218915-96218937 ACCACTTTGGGAGGCCGAAGCGG - Intergenic
1058170212 9:101671072-101671094 ACCACTTTCAGAGGCCTCAGTGG - Exonic
1058944945 9:109847365-109847387 ACTCCCTTTGGAGGCTCTAGGGG - Intronic
1058978618 9:110148436-110148458 TCCTCCTTTGAAGGCCCCAGGGG - Intronic
1059094984 9:111403103-111403125 AACACTTTGGGAGGCCACAGTGG + Intronic
1059138139 9:111827009-111827031 AGCACTTTTGGAGGCCGCGGTGG + Intergenic
1059286743 9:113179414-113179436 ACCACTTTGGGAGGCCGAAGCGG + Intronic
1059346210 9:113630386-113630408 AGCACTTTGGGAGGCCACAGCGG - Intergenic
1059866925 9:118525279-118525301 AGCACTTTGGGAGGCCACAGTGG + Intergenic
1060611111 9:124965480-124965502 AGCACTTTGGGAGGCCACAGAGG - Intronic
1060632504 9:125172452-125172474 ACCACTTTGGGAGGCCGAAGCGG - Intronic
1060722788 9:125989709-125989731 AGCATCCTTGGGGGCCCCAGTGG + Intergenic
1060957174 9:127650439-127650461 ACCAGCTGTGGAGGCTCCATAGG - Intronic
1060982480 9:127801780-127801802 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1060982502 9:127801912-127801934 AACACTTTGGGAGGCCGCAGCGG - Intronic
1061114194 9:128598193-128598215 AGCACTTTGGGAGGCCCAAGTGG - Intronic
1061322963 9:129843180-129843202 AGCACTTTGGGAGGCCGCAGTGG + Intronic
1061693748 9:132355590-132355612 ACCACTTTGGGAGGCCCAGGCGG + Intergenic
1061843869 9:133376038-133376060 ACTTCCTGTGGAGGCCGCAGCGG - Exonic
1062293638 9:135811345-135811367 ACCACCTGTGGCAGCCCAAGCGG - Exonic
1062462590 9:136668122-136668144 CCCACCGGTGGAGGCTCCAGCGG + Intronic
1062569760 9:137179662-137179684 ACTGCCTTTGCAGGCTCCAGTGG - Intronic
1202782816 9_KI270718v1_random:16756-16778 AGCACTTTGGGAGGCCACAGAGG - Intergenic
1203610286 Un_KI270748v1:90124-90146 AGTACCTTTGGAGGCCCAGGTGG + Intergenic
1203656355 Un_KI270753v1:1440-1462 AGCACTTTTGGAGGCCCAGGCGG + Intergenic
1185685181 X:1922837-1922859 ACCACTTTGGGAGGCCGAAGTGG - Intergenic
1186104463 X:6191465-6191487 AGCACTTTTGGAGGCCAAAGCGG + Intronic
1186109556 X:6241563-6241585 AGCACCTTGGGAGGCCCAGGCGG + Intergenic
1186294306 X:8132172-8132194 AGCACTTTTGGAGGCCGAAGTGG + Intergenic
1186311649 X:8326344-8326366 AGCACATTGGGAGGCCCAAGTGG + Intergenic
1186715582 X:12247632-12247654 AGCACTTTTGGAGGCCAAAGTGG - Intronic
1186891450 X:13962830-13962852 AGCACTTTGGGAGGCCACAGTGG - Intergenic
1187395549 X:18916165-18916187 AGCACTTTGGGAGGCCCAAGAGG + Intronic
1187540093 X:20184657-20184679 ACCACTTTGGGAGGCCGAAGTGG - Intronic
1187561628 X:20408762-20408784 ACTCCCTTTGGAGGCTCTAGGGG + Intergenic
1187731465 X:22259409-22259431 AGCACCTTGGGAGGCCCAGGTGG - Intergenic
1188372395 X:29385205-29385227 AGCACATTGGGAGGCCGCAGTGG + Intronic
1188549268 X:31344599-31344621 AACACTTTGGGAGGCCTCAGTGG + Intronic
1188556487 X:31417934-31417956 AGCACTTTGGGAGGCCACAGTGG - Intronic
1189029771 X:37438682-37438704 AGCACTTTGGGAGGCCGCAGTGG - Intronic
1189418283 X:40833360-40833382 AGCACTTTGGGAGGCCGCAGCGG + Intergenic
1189753897 X:44251364-44251386 AGCACCTTGGGAGGCCACAGTGG + Intronic
1190365018 X:49684506-49684528 AGCACTTTTGGAGGCCAAAGTGG - Intergenic
1192618313 X:72650959-72650981 ACCACTTTGGGAGGCCAAAGCGG - Intronic
1192834062 X:74780622-74780644 AGCACTTTGGGAGGCCACAGCGG - Intronic
1193121153 X:77824053-77824075 AGCACTTTGGGAGGCCCAAGTGG - Intergenic
1193122473 X:77838204-77838226 AGCACTTTGGGAGGCCACAGTGG + Intronic
1193381329 X:80819795-80819817 ACCACTTTGGGAGGCCAAAGTGG + Intergenic
1194070541 X:89320151-89320173 AGCACTTTTGGAGGCCACGGCGG - Intergenic
1194709211 X:97214582-97214604 AGCACTTTTGGAGGCCGAAGTGG + Intronic
1195035568 X:100968702-100968724 ACCCCTTTGGGAGGCCACAGTGG + Intergenic
1195371594 X:104180226-104180248 ACCACATTGGGAGGCCAAAGTGG - Intronic
1195910573 X:109885146-109885168 ACCACTTTGGGAGGCCAAAGGGG - Intergenic
1196560186 X:117137265-117137287 AAAACCTTTGCAGGCCACAGTGG + Intergenic
1196636336 X:118007159-118007181 AGCACTTTGGGAGGCCCAAGTGG + Intronic
1196685575 X:118507595-118507617 AGCACCTTGGGAGGCCCAGGCGG - Intronic
1196702339 X:118684519-118684541 ACCACTTTTGGAGGCCGAGGCGG - Intronic
1196739251 X:119010016-119010038 AGCACCTTGGGAGGCCCAGGTGG - Intronic
1197065592 X:122230084-122230106 ACCTCTTTTGGATGCCCCAGGGG - Intergenic
1198674521 X:139117978-139118000 ACCAGCCTTGGAGTCCCTAGTGG - Intronic
1199165750 X:144673045-144673067 AGCACTTTGGGAGGCCGCAGCGG - Intergenic
1199416060 X:147584351-147584373 AGCACCTTGGGAGGCCCAGGCGG - Intergenic
1200237602 X:154475919-154475941 AGCACTTTTGGAGGCCCAGGCGG + Intergenic
1200618056 Y:5405432-5405454 AACACTTTGGGAGGCCCAAGTGG - Intronic
1200724785 Y:6655890-6655912 AGCACTTTTGGAGGCCGCGGCGG - Intergenic
1200798993 Y:7368502-7368524 AGCACTTTGGGAGGCCTCAGTGG + Intergenic
1201603956 Y:15764499-15764521 AGCACCTTAGGAGGCCCGCGTGG - Intergenic
1201773127 Y:17637680-17637702 AGCACTTTTGGAGGCCGAAGTGG - Intergenic
1201828428 Y:18268306-18268328 AGCACTTTTGGAGGCCGAAGTGG + Intergenic