ID: 1175424065

View in Genome Browser
Species Human (GRCh38)
Location 20:58853362-58853384
Sequence GCCCCAGGGGCAGCTGCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 7, 3: 70, 4: 597}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424059_1175424065 -3 Left 1175424059 20:58853342-58853364 CCGAGCAACCACCTTTGGAGGCC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424052_1175424065 19 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424058_1175424065 -2 Left 1175424058 20:58853341-58853363 CCCGAGCAACCACCTTTGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424055_1175424065 16 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424054_1175424065 17 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424051_1175424065 20 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597
1175424053_1175424065 18 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424065 Original CRISPR GCCCCAGGGGCAGCTGCCCC CGG Exonic
900124866 1:1064821-1064843 GGGCCCGGGGCAGCTGCCCTCGG + Intergenic
900124867 1:1064824-1064846 CCACCGAGGGCAGCTGCCCCGGG - Intergenic
900148289 1:1167667-1167689 GACCCTGGGGCTGCTGACCCGGG - Intergenic
900186816 1:1336677-1336699 GTCGCAGGGGCAGCTGCGGCAGG + Intronic
900202858 1:1419159-1419181 GCCTGAGGGGGACCTGCCCCAGG - Exonic
900296896 1:1956405-1956427 GCCTCAGGGGCAGCAGCAGCAGG - Intronic
900329285 1:2126056-2126078 CCCCCAGGTGACGCTGCCCCAGG - Intronic
900460613 1:2800749-2800771 GGCGCTGGGGGAGCTGCCCCTGG - Intronic
900489834 1:2942331-2942353 GCCCCAGGGGCACCTAATCCAGG - Intergenic
900557805 1:3288898-3288920 GACCCAGGGGCAGCAGGCACTGG - Intronic
900598823 1:3494402-3494424 GCCGCAGCGGCAGGTGCCCGTGG + Exonic
900616274 1:3567048-3567070 GCCCCAAGTGCACCTGCCGCTGG - Intronic
900652259 1:3735412-3735434 GGCCCAGGGGCAGCTGTCACTGG + Exonic
900652261 1:3735415-3735437 GTTCCAGTGACAGCTGCCCCTGG - Exonic
900787664 1:4658840-4658862 GACCCAGAGACAGCTGTCCCCGG - Intronic
901167140 1:7229114-7229136 GCCCCAGGCCCTGCTGTCCCTGG - Intronic
901490854 1:9595547-9595569 GACCCAGGGCCACCTGCTCCTGG - Intronic
901604621 1:10449453-10449475 GCCCCAGGGCCAGCAGTGCCTGG + Intronic
901627006 1:10630205-10630227 GCCCCAGGCCCAGCTGCCTTTGG + Exonic
901771291 1:11531635-11531657 CCCCGTGGGACAGCTGCCCCGGG - Exonic
902089704 1:13893306-13893328 ACCCCAGGAGAAGCAGCCCCGGG + Intergenic
902248824 1:15140062-15140084 GCCCAAGGGCCAGCTGGGCCAGG + Intergenic
902269961 1:15296734-15296756 TCCGCAGGGGGAACTGCCCCAGG - Exonic
902417433 1:16249007-16249029 GACCCAGGGCCAGCTGCAGCAGG + Exonic
902835299 1:19043386-19043408 GCCCCAGAGCCAGGAGCCCCAGG - Intergenic
902835570 1:19044707-19044729 GCCCCAGAGCCAGGAGCCCCAGG - Intergenic
903221061 1:21869947-21869969 GCCCCAGGGGCATCTGGACGGGG + Intronic
903363998 1:22794731-22794753 GCTCCAGGGTCAGATGCCCTGGG - Intronic
903567484 1:24279047-24279069 GCCCTTGTGGCACCTGCCCCTGG - Intergenic
903884608 1:26533844-26533866 GCCAGAGGGGCAGATGACCCCGG + Intronic
904611428 1:31728111-31728133 ACCCCAGGGGCCACTGCACCAGG + Intronic
904684181 1:32248684-32248706 GCCCCAGAGGCACCAGCTCCTGG + Exonic
904869635 1:33608364-33608386 GTGCCAGGGACAGCTGCCCTGGG - Intronic
905357746 1:37396550-37396572 GCCCCAGGGGCAGCTGACCCTGG + Intergenic
905357749 1:37396553-37396575 AAGCCAGGGTCAGCTGCCCCTGG - Intergenic
905502548 1:38451167-38451189 GCCTCAGAGGCAGCTGTCCGTGG - Intergenic
906544780 1:46613318-46613340 GCCCCAGGCCCAGCTGGCCATGG - Exonic
906607288 1:47181249-47181271 GTCCCAGGGGCAGCCTCCCAGGG - Intergenic
907048219 1:51312984-51313006 GCCCCAGAGGCAGCTGGTCCTGG + Intronic
910758166 1:90712404-90712426 GCACCAGGGGCCGCTGCAGCTGG + Exonic
910758169 1:90712407-90712429 TCCCCAGCTGCAGCGGCCCCTGG - Exonic
913167928 1:116206103-116206125 GCCCCAGAGGCTGCTGCCATTGG + Intergenic
914915206 1:151815243-151815265 CCCAGACGGGCAGCTGCCCCTGG - Exonic
915246316 1:154558517-154558539 GCCGCAGGGGCAGCAGCAGCCGG - Exonic
915461010 1:156070632-156070654 CCCTCAGGGCCAGCTGCCTCTGG + Intergenic
915562100 1:156693354-156693376 GCCCCAGGGGCGGTGGTCCCAGG - Intergenic
915600967 1:156923167-156923189 GCCACAGGGGCAGGTGCTGCAGG - Intronic
918764179 1:188457312-188457334 GACCATGGGGCAGCTGCTCCAGG - Intergenic
919834297 1:201563182-201563204 GACTCAGGGCTAGCTGCCCCTGG + Intergenic
919910211 1:202106505-202106527 CCCCCAGGAGCAGGTGCACCTGG + Intergenic
919910215 1:202106508-202106530 GACCCAGGTGCACCTGCTCCTGG - Intergenic
919923038 1:202177580-202177602 CCCCAAGGGGCTGCTGGCCCAGG - Intergenic
921067563 1:211633368-211633390 CCCCCAGAGACAGCTTCCCCTGG - Intergenic
921158032 1:212453255-212453277 GGCGCAGGGGCAGCAGCCCAGGG - Intergenic
922619706 1:226982157-226982179 GGCGCGGGGGCTGCTGCCCCGGG + Intronic
922914001 1:229240796-229240818 GCCCCACAGACAGCAGCCCCAGG - Intergenic
923001564 1:230010137-230010159 ACCCTAGGGGCATCTGCTCCAGG + Intergenic
924289860 1:242525235-242525257 GCCCGAGGGGCTACTGCCCCCGG - Intergenic
924862448 1:247937693-247937715 GTCCCAGCGGCAGCTGAGCCTGG - Intronic
1062829849 10:598237-598259 ACCCCAAGGGCAGCTCACCCAGG + Intronic
1065456512 10:25911786-25911808 GACCCAGGAGCTGCTGCCCAAGG + Intergenic
1065529061 10:26650576-26650598 GCCCAATGGACAGATGCCCCAGG + Intergenic
1065557862 10:26934472-26934494 GCCCAATGGACAGATGCCCCAGG - Intergenic
1067082901 10:43221623-43221645 GCAGCAGGGGCAGCTCCTCCTGG - Intronic
1067155606 10:43779037-43779059 GCTCCTTGGGCAGCTTCCCCAGG - Intergenic
1067478322 10:46580156-46580178 GCCCCCAGAGCAGCTGGCCCTGG + Exonic
1067616416 10:47761631-47761653 GCCCCCAGAGCAGCTGGCCCTGG - Intergenic
1067802534 10:49368950-49368972 GACCCAGGGCCAGCTACCCAGGG - Intronic
1069698443 10:70404656-70404678 GGCCCAAGGGCAGCGTCCCCGGG - Intronic
1070716779 10:78728260-78728282 GCCTCAGGGTCAGCTGCACCTGG + Intergenic
1071567705 10:86680286-86680308 GCCCCTGCTGCAGCTGACCCTGG + Intronic
1071567710 10:86680289-86680311 TCCCCAGGGTCAGCTGCAGCAGG - Intronic
1071573766 10:86711642-86711664 GCCGCAGCCGCAGCTCCCCCCGG + Intronic
1073123024 10:101133444-101133466 GCACCAGGCCCTGCTGCCCCAGG - Intronic
1073435703 10:103514488-103514510 AGCCCAGGGGCAGATGGCCCAGG - Intronic
1073589457 10:104742617-104742639 GCCCCAGGCCCAGCTGTCCAAGG - Intronic
1074205235 10:111277387-111277409 GGCCCAGGGGCAACTGCCCTGGG + Intergenic
1074536080 10:114329457-114329479 GACCCACCAGCAGCTGCCCCTGG + Intronic
1074758502 10:116646502-116646524 GCCCTGTGAGCAGCTGCCCCAGG - Intergenic
1075261759 10:120969547-120969569 GTCCCAGGGGCTGCTGGCTCAGG + Intergenic
1075413600 10:122246989-122247011 GCCCCAGGGGGTCCCGCCCCAGG - Intronic
1075472574 10:122703979-122704001 GCTGCAGGGGCAGCTGCCAGAGG - Intergenic
1075659394 10:124182910-124182932 GCCAGAGGGGCAGGTGCCCATGG - Intergenic
1076176593 10:128372969-128372991 GGCCCAGGGGACGCTGCCACTGG + Intergenic
1076295179 10:129378439-129378461 GCCCCAGGCCTAGCTGCCTCTGG + Intergenic
1076387374 10:130067066-130067088 GGCCCAGGGCCAGCTGCTTCTGG + Intergenic
1076423671 10:130351986-130352008 GCCCCCGGGGCCTCTGCTCCAGG - Intergenic
1076728585 10:132425961-132425983 GCTCTAGGGACAGCTGGCCCAGG - Intergenic
1076729708 10:132432249-132432271 GCCCCAGGAGAAGCAGCCCCGGG + Intergenic
1076729713 10:132432252-132432274 GCCCCCGGGGCTGCTTCTCCTGG - Intergenic
1076861388 10:133139833-133139855 GATGCAGGGGCAGCTGCCCGTGG - Intergenic
1076882873 10:133248079-133248101 GCTCCCGGGCCAGCAGCCCCCGG - Intergenic
1076904241 10:133354451-133354473 GCCCCGGGGACACCAGCCCCAGG + Intergenic
1076996150 11:298436-298458 GCCCCAGGGGCAGCAGCCTGGGG + Exonic
1077106303 11:843976-843998 GCCACTGGGGAAGCTGCCCAGGG - Intronic
1077124128 11:925066-925088 TCCGCAGGGGCTGCCGCCCCCGG + Intronic
1077206082 11:1345160-1345182 GCTGCAGGTGCAGATGCCCCAGG + Intergenic
1077336642 11:2008060-2008082 GCCGCAGAGGCAGCTGCGGCTGG - Intergenic
1077363094 11:2149547-2149569 GCCGCTGGGGCAGCTGGCTCAGG + Intronic
1077496942 11:2891022-2891044 ACCCCAAGGGAAGCAGCCCCTGG - Intronic
1077497858 11:2895227-2895249 GCTCCAGGGCTGGCTGCCCCAGG + Intronic
1077532815 11:3105226-3105248 AGCCCAACGGCAGCTGCCCCAGG + Intronic
1079183100 11:18210992-18211014 CCCCCAGGGGCAGCTGCAGAGGG + Intronic
1081573647 11:44306387-44306409 GGCCCAGGCTCAGCTGCCCGGGG + Intronic
1081668636 11:44931198-44931220 GACCCAGGGGGACCTGCCACTGG + Exonic
1081671511 11:44945230-44945252 CCCCCAGGGCCACCTACCCCGGG + Intronic
1083227057 11:61291876-61291898 GCCCCAGGGGTGGCTGCCTCAGG + Intronic
1083227889 11:61295832-61295854 GCCCCTTCTGCAGCTGCCCCAGG + Intergenic
1083292394 11:61697218-61697240 GCCCCAGGGTAAGGTGGCCCTGG + Intronic
1083764865 11:64836863-64836885 GCCCTAGGGGCTGCTGCTGCGGG - Intronic
1083774519 11:64887974-64887996 AACCCAGGGGCTGCTCCCCCAGG + Intronic
1083778759 11:64907337-64907359 GCCTCAGGGGCAGCGGCCTGTGG + Exonic
1084216408 11:67649031-67649053 GCCCTGGGGGCAGCTGTCACCGG + Intronic
1084508619 11:69587385-69587407 GACACAGGGGCAGGTGCCCAGGG - Intergenic
1084546780 11:69818670-69818692 GCCCCGGGGGAAGCGGCGCCGGG - Intronic
1084557069 11:69881635-69881657 GCCCCAGGAGAAGAGGCCCCAGG + Intergenic
1084660616 11:70544453-70544475 CTCCCACGGGCAGCTGCTCCGGG - Intronic
1085266572 11:75241076-75241098 GCTCCAGGGGCTGCTGCTCGTGG + Exonic
1085306187 11:75487363-75487385 GTCACAGGGGCAGCTGCCAGTGG + Intronic
1085455684 11:76664140-76664162 GTCTCAGGGGCTGGTGCCCCAGG - Intronic
1086165213 11:83769892-83769914 GTTCCAGTGGCAGCTGCCCCAGG + Intronic
1086165215 11:83769895-83769917 GGCCCTGGGGCAGCTGCCACTGG - Intronic
1088099204 11:106135986-106136008 GCCACAGGGGCAGCTGTCAATGG + Intergenic
1088754901 11:112877775-112877797 GCCCCAGGCCCTGCTGGCCCCGG + Intergenic
1089214994 11:116829919-116829941 TCCCTAGAGGCAGCTGCTCCAGG + Exonic
1090266951 11:125359310-125359332 GCCCCAGGGGCAACACCCCAGGG + Intronic
1090405864 11:126475542-126475564 ACCCCAGGGGCAGCGAGCCCCGG + Intronic
1090965981 11:131597985-131598007 GCCCCAGGGACAGGAGCCACAGG + Intronic
1091041272 11:132284059-132284081 GCCCCTGGGGCCTCAGCCCCAGG + Intronic
1202819626 11_KI270721v1_random:63242-63264 GCCGCAGAGGCAGCTGCGGCTGG - Intergenic
1091399481 12:173576-173598 GCCCCAGGTGGTGCTGCCCGAGG + Intronic
1091409229 12:228394-228416 TCCCCAGGAGCTCCTGCCCCTGG + Intronic
1091699651 12:2651280-2651302 GGCCCAGAGCCAGCTGCCCTGGG - Intronic
1091772005 12:3158181-3158203 GCCCCAGGGGATGCTCCTCCGGG - Intronic
1091784675 12:3235961-3235983 GCCCCAGCGGCAGCAGGTCCAGG - Intronic
1092291412 12:7161560-7161582 GCCCCAGAGGCAGCTGATCCAGG - Intergenic
1092746198 12:11674815-11674837 GCCCCAGGAGCGGAGGCCCCTGG + Intronic
1092777125 12:11953509-11953531 ACCCCAGGTGCTGCTACCCCAGG + Intergenic
1092799416 12:12149189-12149211 GCCTCAGGGTTATCTGCCCCTGG - Intronic
1096079986 12:48826862-48826884 GGCACAGGAGCAGCTGACCCAGG - Intronic
1096238296 12:49944375-49944397 GTCCCGGGGGCATCTGCCCAGGG - Intergenic
1096705114 12:53415965-53415987 ACACCAGTGGCAGCTGCCCCAGG + Intronic
1096705116 12:53415968-53415990 GGCCCTGGGGCAGCTGCCACTGG - Intronic
1097220744 12:57449536-57449558 GCTCCAGGGTCAGGTGCCCCTGG - Exonic
1101041255 12:100758186-100758208 GCCCCAGAGTCACCTGCCCGCGG + Intronic
1101538537 12:105643008-105643030 GCACCCGAGCCAGCTGCCCCAGG + Intergenic
1101836635 12:108300228-108300250 GCTCCAGGAGCAGGTGCGCCAGG + Intronic
1102584257 12:113912145-113912167 GCCCCAGGCACTGCTGCCTCGGG + Intronic
1102853893 12:116277304-116277326 GCGCCGGGGGCAGCGGGCCCGGG + Exonic
1103209593 12:119156801-119156823 GCCCCTGAGCCAGCTGCCCGTGG + Exonic
1103209598 12:119156804-119156826 CCCCCACGGGCAGCTGGCTCAGG - Exonic
1103209997 12:119158637-119158659 GGGACAGGGGCAGGTGCCCCGGG + Exonic
1103507784 12:121453305-121453327 GCCCAAGGGGAAGCTGGGCCCGG - Exonic
1103968396 12:124654586-124654608 TCCCCAGAGGCAGTGGCCCCTGG - Intergenic
1104556748 12:129807204-129807226 GCTACAGGGGTAGCTGCTCCAGG - Intronic
1104710017 12:130979096-130979118 ACACCAGCGTCAGCTGCCCCAGG + Intronic
1105016759 12:132790658-132790680 GCTCCAGTGACAGCCGCCCCTGG + Intronic
1105781564 13:23709267-23709289 GCCACAGGGCCAGCTACCCAAGG - Intergenic
1106347396 13:28892307-28892329 GCTCCAGCACCAGCTGCCCCAGG - Intronic
1106358811 13:29010916-29010938 GCCCCTGGGAGAGGTGCCCCTGG + Intronic
1107603793 13:42040064-42040086 GCTCCAGGGCAAGCTGCGCCGGG - Intronic
1107959909 13:45548464-45548486 TCCTCTGGAGCAGCTGCCCCTGG + Intronic
1108500507 13:51065957-51065979 GCCCCAGGAGCAGCTGCGGCAGG - Intergenic
1108525346 13:51281203-51281225 CCCCCAGGGTCGGCTGGCCCCGG + Exonic
1113656684 13:112072323-112072345 GCCTCTGGAGCCGCTGCCCCCGG - Intergenic
1113662192 13:112115142-112115164 CCCACAGTGCCAGCTGCCCCAGG - Intergenic
1113702153 13:112395986-112396008 ACCCCAGGGTGAGCTGCCCAGGG - Intronic
1115962749 14:38854025-38854047 GCTGCAGGGGTGGCTGCCCCAGG + Intergenic
1116756771 14:48958043-48958065 GCCATGGGGGCAGCTTCCCCTGG + Intergenic
1117396122 14:55312296-55312318 GCCACAGGTGGAGCTGCCCAAGG - Intronic
1118332253 14:64823680-64823702 CCCCCCAGTGCAGCTGCCCCGGG - Intronic
1118772764 14:68953008-68953030 TCCCTAGGGGCATCTGCCACTGG + Intronic
1118796697 14:69151742-69151764 GCCGCGGCGACAGCTGCCCCTGG - Intronic
1119092870 14:71801022-71801044 GCCACAGGGGGATTTGCCCCAGG + Intergenic
1119436403 14:74600422-74600444 GCCCCAGTGGGTGCTGCGCCAGG - Intronic
1119487668 14:75002478-75002500 GCCCAAGGGGCAGCCGACCCTGG + Intergenic
1120860771 14:89253332-89253354 TCCCCAGGGAGAGCTGCCCAGGG + Intronic
1120878498 14:89396350-89396372 GGCCAAGGGGCAGCTGACCAAGG + Intronic
1121308765 14:92923618-92923640 GCACAAGGGGGAGTTGCCCCGGG - Intronic
1121472452 14:94165937-94165959 GCCCCAGAGGCTGCTGAGCCAGG + Intronic
1122418271 14:101560646-101560668 GCCCCGGCGGCCGCTGACCCAGG + Intergenic
1122816186 14:104315311-104315333 GGCTCTGGGGCAGCTGGCCCTGG + Intergenic
1122834892 14:104425754-104425776 GCCCCAGAGTCACCTGCCCTGGG + Intergenic
1122905941 14:104801576-104801598 GCCCCAGGGGCAGGGTTCCCCGG - Exonic
1122938560 14:104971006-104971028 GCCCCCAGGGCAGCCGACCCTGG + Intronic
1123051766 14:105547465-105547487 GCCCCAGGGGGCACTGCCTCAGG - Intergenic
1123077181 14:105673169-105673191 GCCCCAGGGGGCACTGCCTCAGG - Intergenic
1123467729 15:20528925-20528947 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1123650384 15:22472117-22472139 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1123728042 15:23124134-23124156 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1123740792 15:23280959-23280981 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1123746206 15:23321599-23321621 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1124158568 15:27249500-27249522 GCCAGATGGGCAGCTGCCCCCGG + Intronic
1124278473 15:28344916-28344938 GCCTCTGGGGTAGCAGCCCCAGG + Intergenic
1124304227 15:28566692-28566714 GCCTCTGGGGTAGCAGCCCCAGG - Intergenic
1125535676 15:40440438-40440460 GCCCTGGGGGCAGCAGCCTCCGG + Intronic
1125577897 15:40767607-40767629 GTTCCTCGGGCAGCTGCCCCGGG + Exonic
1125722343 15:41851337-41851359 GCTCCTGGGACAGCTGCCGCGGG - Exonic
1125824928 15:42668134-42668156 GCCAGAGGGGCAGCTGTGCCAGG + Intronic
1126172682 15:45707461-45707483 GCAGCAGAGGCAGATGCCCCAGG - Intergenic
1128096504 15:64960371-64960393 TTCCCAGAGGCAGCTGCCCTGGG - Intergenic
1129227035 15:74176070-74176092 GGCCTGGGGGCAGCTGCCCAGGG - Exonic
1129685639 15:77684802-77684824 GCCCAGGGGGCAACTGGCCCAGG + Intronic
1131180170 15:90233975-90233997 GCCCCAGGAGCGGTTGCCGCGGG - Exonic
1131260348 15:90884523-90884545 CCCGCACGGGCAGCTGCTCCTGG - Exonic
1131425055 15:92339255-92339277 GCCCCAGGCCCAGCTGTCCAGGG + Intergenic
1132504014 16:297811-297833 GCCCCAGGCGAAGCTGCTCTGGG + Exonic
1132600162 16:769595-769617 TCGCCAGGGGCAGGTACCCCAGG + Exonic
1132600165 16:769598-769620 CCCCCTGGGGTACCTGCCCCTGG - Exonic
1132677798 16:1127792-1127814 CCCTCAGGGGCATCTGTCCCAGG - Intergenic
1132684129 16:1155227-1155249 GTCCCGGGGGCAGCCGGCCCCGG + Intronic
1132744707 16:1431819-1431841 GCTCCAGGGGCCACTGCACCTGG - Intergenic
1132804282 16:1768530-1768552 GAGGCAGGGGCAGCTGGCCCAGG - Exonic
1132805656 16:1773915-1773937 GTCCCTGAGGCAGCTGCCCTGGG + Intronic
1132867789 16:2102482-2102504 GACAGAGGGGCTGCTGCCCCTGG - Exonic
1134523989 16:14930632-14930654 GACAGAGGGGCTGCTGCCCCTGG + Intronic
1134548914 16:15130303-15130325 GACAGAGGGGCTGCTGCCCCTGG - Intronic
1134711582 16:16329117-16329139 GACAGAGGGGCTGCTGCCCCTGG + Intergenic
1134719433 16:16372416-16372438 GACAGAGGGGCTGCTGCCCCTGG + Intergenic
1134947993 16:18339469-18339491 GACAGAGGGGCTGCTGCCCCTGG - Intergenic
1134955247 16:18379576-18379598 GACAGAGGGGCTGCTGCCCCTGG - Intergenic
1135480001 16:22814408-22814430 CCCCGAGGAGCCGCTGCCCCCGG + Exonic
1135894076 16:26382779-26382801 TCCCCAGGGCTAGCTTCCCCTGG - Intergenic
1136251470 16:29008395-29008417 GCCCCAGAGCCAGCAGCCCCAGG - Intergenic
1136278263 16:29192130-29192152 GCCCCAGCAGCAGCACCCCCAGG - Intergenic
1136750146 16:32628291-32628313 GCCCAAGGAGCAGCTTCCACAGG - Intergenic
1137231610 16:46572135-46572157 GACCCAAGGGCAGCTGTCCCTGG + Intergenic
1137231612 16:46572138-46572160 GTGCCAGGGACAGCTGCCCTTGG - Intergenic
1138730120 16:59185066-59185088 GTCCCAGGGGCAGCTTCAGCAGG - Intergenic
1139473745 16:67192242-67192264 GCCACAGGCGCCGCCGCCCCCGG + Exonic
1140207794 16:72947765-72947787 GCTCCAGATGCAGCTGACCCGGG - Intronic
1140770352 16:78198145-78198167 GCTCCTGGGGCAGGTGCCTCTGG + Intronic
1140770355 16:78198148-78198170 CCCCCAGAGGCACCTGCCCCAGG - Intronic
1141312740 16:82930958-82930980 CCCACAGGGGCAGCTTCCGCTGG + Intronic
1141475459 16:84270196-84270218 ACTCCAGGGCCAGCTGCTCCGGG + Intergenic
1141531523 16:84649429-84649451 GCCCCAGGGGGGGTTGCCCAAGG - Intronic
1141839242 16:86564061-86564083 GCTCCAGGTGCAGCGGCCACGGG + Intergenic
1141961668 16:87413151-87413173 GCCCCATCACCAGCTGCCCCGGG - Exonic
1142057062 16:88004610-88004632 ACACCAGGGGCAGCTGCCGCCGG + Intronic
1142057065 16:88004613-88004635 TCCCCGGCGGCAGCTGCCCCTGG - Intronic
1142082641 16:88158164-88158186 GCCCCAGCAGCAGCACCCCCAGG - Intergenic
1142215510 16:88827834-88827856 GCCCCTGGGGCAGCTGGGCAGGG + Intronic
1142247234 16:88975737-88975759 GCCCCACGGGCAGCTGCAGGTGG + Intronic
1142282592 16:89156400-89156422 GACCCAGGAGCAGGTGCCCTGGG + Intergenic
1142283741 16:89162521-89162543 CCTCCAGGTGCGGCTGCCCCGGG + Intergenic
1203052276 16_KI270728v1_random:887490-887512 GCCCAAGGAGCAGCTTCCACAGG - Intergenic
1142639692 17:1278940-1278962 GCCCCTAGGTCAGCTGCTCCGGG - Intergenic
1142904821 17:3034534-3034556 GCCCCAGACGCAGCTGCCCAAGG - Exonic
1142957555 17:3531871-3531893 GCCCTCGGGGCAGCTGACCAGGG + Intronic
1143054797 17:4154827-4154849 GCACCAGAGCCGGCTGCCCCTGG - Exonic
1143095413 17:4476129-4476151 GCCCTGGTGGCCGCTGCCCCGGG + Intronic
1143103354 17:4515797-4515819 GCACCAGGGGCTGCTGGGCCAGG + Intronic
1143110824 17:4551933-4551955 GACCAAGGAGCAGCTGCACCTGG - Exonic
1143117108 17:4587296-4587318 AGCCCAGCGGCAGCTGCCTCAGG - Intronic
1143274932 17:5703350-5703372 GCCCCAGGCGCAGATCCCCCGGG - Intergenic
1143387987 17:6543433-6543455 GCCCCAGGGGCAGAGTCCTCAGG + Intronic
1143538366 17:7555349-7555371 GCCCCTGGGGCAAAAGCCCCGGG + Intronic
1143614729 17:8042919-8042941 GCCACAGGAGCTGATGCCCCAGG - Intronic
1144500557 17:15783044-15783066 GCCCCCGGTTCAGCTGCTCCGGG - Intergenic
1144547941 17:16215271-16215293 GTCCCAGCGGCTGCTGCCCCGGG + Intronic
1144547943 17:16215274-16215296 GCTCCCGGGGCAGCAGCCGCTGG - Intronic
1144565156 17:16353521-16353543 GGCCCAGGGGGCGCTGCGCCCGG + Intronic
1144764443 17:17725026-17725048 GGCCCAGGGTCAGCAGCCCCAGG - Intronic
1144855278 17:18264097-18264119 GCCCCCGTGGGAGCAGCCCCTGG + Exonic
1144855282 17:18264100-18264122 GTCCCAGGGGCTGCTCCCACGGG - Exonic
1145413586 17:22694673-22694695 GCTCCAGGGGCTGCTGGGCCTGG + Intergenic
1146724683 17:35147731-35147753 GCCACAGGGGCAGGTGCCCCTGG - Intergenic
1146948245 17:36888690-36888712 GCCCCTGGGGCAGCTGAAGCTGG - Intergenic
1147156920 17:38548655-38548677 GCCCCAGGTGAAGCTGCGCCGGG - Exonic
1147375868 17:40022272-40022294 GCCCTTGGGGCAGCTGTGCCTGG - Intronic
1147722228 17:42546475-42546497 GCCCCCTGGGCAGATTCCCCTGG - Intergenic
1147723412 17:42552645-42552667 GCCCCCTGGGCAGATTCCCCTGG - Exonic
1147965131 17:44190628-44190650 CCCCCAGGGTCAGCTGTTCCAGG + Exonic
1148022483 17:44562587-44562609 GCCCCAGGCCCAGGTGCCACAGG - Intergenic
1148325645 17:46782058-46782080 GACCCAGGGGCTGCGGCCCAGGG + Intronic
1148406959 17:47424024-47424046 GCCCGAGGGCCCGCTGCTCCGGG + Intronic
1148677456 17:49453468-49453490 GTCCCAGGGGCCCCTCCCCCAGG - Intronic
1148769112 17:50056724-50056746 TCCCAAGGGCCAGCTGCCCTGGG - Intronic
1148786354 17:50148036-50148058 GCCCCAGGCTCAGCTGCACCCGG - Intronic
1148858112 17:50590272-50590294 CACCCAGGGGCAGGGGCCCCAGG - Intronic
1148957284 17:51364347-51364369 ACCCCAGGTGCTTCTGCCCCAGG - Intergenic
1149858457 17:60106338-60106360 GCACCAGGAATAGCTGCCCCTGG + Intergenic
1149867082 17:60157057-60157079 GGCCCAGGGGCAGCTGGGCTGGG + Intronic
1150004783 17:61462964-61462986 GCCCCTTGGGCATCTGCCCTTGG - Intronic
1150904902 17:69326988-69327010 CCCCCAGGGACGGCTGTCCCAGG + Intronic
1151747343 17:76018585-76018607 CCCCCAGGTGCAGCTGCTGCAGG - Exonic
1151842323 17:76627182-76627204 GCCCCAGCAGCAGCTGCTCCTGG - Exonic
1152039186 17:77892204-77892226 GCCACAGTGGCAGAGGCCCCTGG - Intergenic
1152062316 17:78086894-78086916 GCACCAGCGCCAGCTGGCCCAGG + Exonic
1152238728 17:79151296-79151318 TCCCGTGGGGCAGCTGACCCAGG - Intronic
1152426349 17:80220567-80220589 GCCCCCGCGTCGGCTGCCCCCGG - Intronic
1152466025 17:80466612-80466634 GCCTCTGCGTCAGCTGCCCCTGG + Intergenic
1152550209 17:81026001-81026023 AGCCCTGGGGCAACTGCCCCCGG + Intergenic
1152579568 17:81160056-81160078 CCCCCTGGGGCAGGTGGCCCCGG + Intronic
1152608116 17:81303124-81303146 GCTCCAGAAGCCGCTGCCCCAGG + Intergenic
1152736842 17:82001267-82001289 GGGCCAGGGGCTCCTGCCCCTGG + Intronic
1152736843 17:82001270-82001292 GGTCCAGGGGCAGGAGCCCCTGG - Intronic
1152889350 17:82871667-82871689 GCGCCGGTGGCAGATGCCCCTGG + Intronic
1152889351 17:82871670-82871692 CCACCAGGGGCATCTGCCACCGG - Intronic
1152902344 17:82950131-82950153 GCCACACTGCCAGCTGCCCCTGG + Intronic
1152920518 17:83064300-83064322 GCTGCAGAGGCAGCTGCCCTGGG - Intergenic
1153666509 18:7371470-7371492 GGCCCTTGGGCAGCTGGCCCGGG + Intergenic
1154241344 18:12657218-12657240 GCCCGCGGGACAGCTGCCCGCGG - Intronic
1156491146 18:37496970-37496992 GCTCTAGAGGCAGCTGGCCCCGG + Intronic
1156538858 18:37890313-37890335 GCCCCTGTGGCAGCTGCTCATGG + Intergenic
1156538861 18:37890316-37890338 GCACCATGAGCAGCTGCCACAGG - Intergenic
1158332396 18:56376807-56376829 GCCCCCAGGGCAGGAGCCCCAGG - Intergenic
1158725677 18:59969576-59969598 GCCCGAGGGCCAGCTGCTCCGGG + Intergenic
1159718034 18:71849606-71849628 GCCACAGGGGGAGCTGCCCAAGG + Intergenic
1159983983 18:74820269-74820291 GCCCCACAGGCAACTGCCCAGGG + Intronic
1160592522 18:79952126-79952148 GCCCCACGAGCAGATGCGCCGGG + Intergenic
1160692768 19:467395-467417 GCCACAGAGGCAGCTGGCCTAGG - Intronic
1160925454 19:1542803-1542825 GCCCCAGAGGTAGCCGCCCTTGG - Intergenic
1160953739 19:1679989-1680011 CCCCCCGGGGCAGCTGCCAAGGG + Intergenic
1161077128 19:2291230-2291252 GCTCCAGGGTCAGCTCCTCCAGG + Exonic
1161126714 19:2561950-2561972 CCAGCAGAGGCAGCTGCCCCGGG + Intronic
1161222379 19:3123587-3123609 GCCCGGGCGGCAGCAGCCCCCGG + Exonic
1161224424 19:3136467-3136489 GCACCAGGGGCAGCAGCGCCAGG - Exonic
1161374709 19:3933511-3933533 TCCCCAGGGGCCGCCTCCCCCGG + Exonic
1161374714 19:3933514-3933536 GCCCCGGGGGAGGCGGCCCCTGG - Exonic
1161572350 19:5037493-5037515 GTGCCAGGGACAGGTGCCCCAGG + Intronic
1161572351 19:5037496-5037518 GCGCCTGGGGCACCTGTCCCTGG - Intronic
1161952874 19:7477423-7477445 GCCCCACAGCCCGCTGCCCCGGG - Exonic
1162021178 19:7869323-7869345 CCCCCAGTGGCAGCTCGCCCAGG + Exonic
1162112043 19:8404623-8404645 GCCACAGGGGCAGCTTGACCAGG - Intronic
1162164462 19:8743070-8743092 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162164548 19:8743405-8743427 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162165534 19:8750538-8750560 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162165620 19:8750873-8750895 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162166599 19:8757994-8758016 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162166685 19:8758329-8758351 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162167665 19:8765450-8765472 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162167751 19:8765785-8765807 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162168604 19:8771748-8771770 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162168690 19:8772083-8772105 GCTCCAGGGGCAGCTGTGCAGGG + Intergenic
1162170350 19:8784512-8784534 GCCCCAGGAACTCCTGCCCCAGG + Intergenic
1162235901 19:9309578-9309600 GCCACAGGGGCAGCTGACCCGGG + Intronic
1162330752 19:10027777-10027799 GCGGCAGGCGCAGCTGCTCCGGG + Intergenic
1163027406 19:14520277-14520299 TGCCCAGGGGCAGCTGTCACTGG - Intronic
1163105354 19:15120008-15120030 GCCCGAGGGACCGCTGCCCCTGG - Exonic
1163291763 19:16383871-16383893 GCCCCATGCCCAGGTGCCCCAGG - Intronic
1163426072 19:17241641-17241663 ACCCCAGGGGTAGTTGCTCCAGG - Intronic
1163774162 19:19208247-19208269 CCCCCACTGGCAGCAGCCCCTGG + Intergenic
1164039528 19:21483069-21483091 GCTCCAGTGGCAGCTGCCGAGGG + Intronic
1164207675 19:23071417-23071439 GCTCCAGCGGCAGCTGCCGAGGG - Intergenic
1164934874 19:32202467-32202489 GCCCCAGCGGGAGCTACCCGGGG - Intergenic
1165062203 19:33210437-33210459 GGCACAGGGCCAGCTGTCCCAGG + Intronic
1165112245 19:33509242-33509264 GCCCCAAAGGCAGTTGGCCCGGG + Intronic
1165404792 19:35622933-35622955 GCCCCAGTGGCGGCTGCGCTGGG + Exonic
1165461353 19:35945907-35945929 GCCCCAGGGGAAGCTGGGGCAGG + Intergenic
1165466226 19:35976717-35976739 GCCAAAGGGGCAGCTGGCCATGG - Intergenic
1165810321 19:38607989-38608011 ACCTCAGGAGCAGCAGCCCCAGG - Exonic
1165857677 19:38889760-38889782 GCCAGAGGGCCAGATGCCCCAGG + Intronic
1166039105 19:40191566-40191588 GCCCCTGGGGCGGCCGCCCCGGG - Intergenic
1166730582 19:45057042-45057064 TCCTCAGAGGCAGCTGCTCCAGG - Intronic
1166869734 19:45864164-45864186 GCGCCGGGGGCCGCAGCCCCAGG - Intronic
1167645656 19:50703671-50703693 GCCCCAGAGGACGCGGCCCCCGG + Exonic
1167921530 19:52786664-52786686 GTCCCAGGGGCAGAAGCGCCGGG + Exonic
1168311611 19:55463633-55463655 GCCTCAGGTCCAGCTGGCCCAGG + Intergenic
926159214 2:10475964-10475986 GCCAGAGGGGAAGCTGCCCGGGG + Intergenic
926211989 2:10878137-10878159 GCTCCCGGTCCAGCTGCCCCCGG + Intergenic
927278152 2:21279321-21279343 ACCTCAGGGTCAGCTGCCCAGGG + Intergenic
927854709 2:26520695-26520717 GACTCAGGGGCAGCAGCTCCAGG - Intronic
929593553 2:43162021-43162043 GCCCCAGGGTGAGCTGGCCGGGG + Intergenic
930530279 2:52580803-52580825 CCAGCAGGGGCAGCTGCCACAGG - Intergenic
930616481 2:53599693-53599715 GCCCCATGGGGACTTGCCCCAGG - Intronic
931219992 2:60280461-60280483 GCATCAGCGGCAGCAGCCCCAGG - Intergenic
932413850 2:71562266-71562288 GTGCCAGGGCCAGCTTCCCCAGG + Intronic
932743742 2:74313882-74313904 ACCCAAGAGGCAGCTGCCCTAGG + Intronic
932779914 2:74553620-74553642 GACCCAGGGGCAGCGCCTCCCGG + Intronic
933634037 2:84687693-84687715 GCCCCAGGGGCACTTTCTCCTGG - Intronic
934572492 2:95381829-95381851 GCCCCAGGGACAGCAGCCAGTGG + Intronic
934572695 2:95382705-95382727 GGCCCAGGGTCAGCTGCCTCAGG - Intronic
934770821 2:96906791-96906813 GCCCCAGCAGCAGCTGGGCCGGG + Intronic
937074165 2:119088930-119088952 GCCCCAGGTGCAGCATCCGCAGG + Intergenic
937119391 2:119431561-119431583 GCCCCAGGCGAAGCTGTCCTCGG + Intronic
937205795 2:120236442-120236464 GCCCAAGGGGCAGCTGCACCTGG - Intergenic
937923084 2:127146125-127146147 CCCCCAGGGGCCCCTGCCCAGGG - Intergenic
938548107 2:132353206-132353228 GCCACAGGGACATCTGGCCCTGG - Intergenic
939172196 2:138709215-138709237 GAAACAGGGGCAGCTGCCCAGGG + Intronic
940854884 2:158722323-158722345 GCCTCAGGGGCAGCAGGTCCAGG + Intergenic
941053900 2:160765995-160766017 ACCCCACAGGCAGCTGCCACAGG - Intergenic
946248300 2:218399301-218399323 GCCCCAGGGCGAGGTGCCCCCGG - Intronic
947534768 2:230933695-230933717 GGCGCAGGGGCTGCTGCTCCTGG - Intronic
947586096 2:231357931-231357953 GCCCCAGGTGCAGTTTCCTCTGG + Intronic
948309002 2:236971232-236971254 GTCCTATGAGCAGCTGCCCCGGG - Intergenic
948462042 2:238134457-238134479 GCCTCTGGGGGAGCTGCCCCAGG + Intergenic
948467105 2:238157954-238157976 CCACCAGGGGCAGGTGCCTCGGG + Intergenic
948467108 2:238157957-238157979 ACCCCCGAGGCACCTGCCCCTGG - Intergenic
948746116 2:240095553-240095575 GCACCAGGGGCCCCTGCACCCGG - Intergenic
948770317 2:240248358-240248380 TCCTCAGGGGCAGCTGCCTCAGG + Intergenic
948782345 2:240329537-240329559 GCAGCTGGGGCAGCAGCCCCTGG + Intergenic
948798975 2:240421579-240421601 GCCCCAGGAGAAGCTGGCCAGGG + Intergenic
948861587 2:240755173-240755195 CCCCCAGGGGCCTCTGCCTCTGG - Intronic
948877397 2:240836938-240836960 TCCCCAGGAGCAGCTGGTCCTGG - Intergenic
948908489 2:240991332-240991354 TCCCCAGGGCCGCCTGCCCCTGG - Intronic
948931920 2:241137479-241137501 GCCCCAGGCACAGCAACCCCAGG + Intronic
949049417 2:241888995-241889017 GCACCTGGGACAGCTGCCCGGGG + Intergenic
1168842292 20:917130-917152 GCCCCAGGACAATCTGCCCCAGG - Intergenic
1169467121 20:5850989-5851011 TCTCCAGGGGCAGCTGGCCAAGG + Intronic
1169907041 20:10614705-10614727 GCCCCAGGGTCAGATGCTGCTGG - Intronic
1171490047 20:25510433-25510455 GACCCAGGGGCAGAGGCCCGTGG - Intronic
1171876976 20:30585978-30586000 GCCACAGGGACATCTGGCCCTGG - Intergenic
1172135112 20:32681482-32681504 TCCCCAGAGCCAGCTGCCCCAGG + Intergenic
1172192178 20:33068805-33068827 GGTGCAGGGGCAGCTTCCCCAGG - Exonic
1172356472 20:34283798-34283820 GCCCTGGAGGCAGATGCCCCAGG + Intronic
1172565822 20:35929563-35929585 ACCCCAGAGGCAGCTGCTGCAGG - Intronic
1172592560 20:36127975-36127997 GCCCCAGGGTCAGAAGCCCGGGG + Intronic
1174138410 20:48396367-48396389 ACCCCAGAGGCAACTGCTCCTGG + Intergenic
1174174153 20:48634566-48634588 GCCTCTGGGCCAGCTGCCCAAGG - Intronic
1174201503 20:48809458-48809480 ACCCAGGAGGCAGCTGCCCCAGG + Intronic
1174503877 20:51004479-51004501 GCCCCAGCGTCTGCAGCCCCAGG + Exonic
1175165749 20:57043249-57043271 GAGCCAGTGGCAGCTGTCCCAGG + Intergenic
1175263134 20:57687260-57687282 GCCCCAGGCACAGGTGCCCCAGG - Intronic
1175424065 20:58853362-58853384 GCCCCAGGGGCAGCTGCCCCCGG + Exonic
1175424068 20:58853365-58853387 GCACCGGGGGCAGCTGCCCCTGG - Exonic
1175781219 20:61683471-61683493 GGCCCGTGGGCAGGTGCCCCGGG + Intronic
1175908784 20:62394818-62394840 CCCCCAGGTGCGGCTGCCCCCGG - Intronic
1176107895 20:63398143-63398165 CCCCCCAGGGCAGCTGCCCCGGG - Intergenic
1176423210 21:6532711-6532733 CCTCCAGGTGCAGCTGCTCCAGG + Intergenic
1176604822 21:8820191-8820213 TGCCCAGGGGCGGCTGCACCGGG + Intergenic
1178293366 21:31387819-31387841 GCCCCTGGGGAAGGTGCGCCTGG - Intronic
1178457724 21:32771423-32771445 GCCGCCGGGGAAGCCGCCCCCGG + Exonic
1179529636 21:42009924-42009946 ACCCCAGGGGCAGCTCGGCCAGG + Intronic
1179581563 21:42347753-42347775 GTCCCGGGGGATGCTGCCCCAGG - Intronic
1179647001 21:42782171-42782193 GTCCCAGGAGCAGCTGCACTGGG + Intergenic
1179698703 21:43141027-43141049 CCTCCAGGTGCAGCTGCTCCAGG + Intergenic
1179831596 21:44000466-44000488 GCCCCAAGGGAGGCTCCCCCTGG - Intergenic
1179889244 21:44327426-44327448 GCCCAGTGGGCAGCAGCCCCAGG + Intergenic
1179967157 21:44813861-44813883 GACCCAGATGCAGCTGCCCGAGG - Exonic
1180132574 21:45835883-45835905 GCCCCAGGGGAACAGGCCCCAGG + Intronic
1180159688 21:45993488-45993510 GCCTCAGAGGCAGCGCCCCCGGG + Intronic
1180347112 22:11711796-11711818 TGCCCAGGGGCGGCTGCACCGGG + Intergenic
1180354862 22:11829886-11829908 TGCCCAGGGGCGGCTGCACCGGG + Intergenic
1180383389 22:12162445-12162467 TGCCCAGGGGCGGCTGCACCGGG - Intergenic
1180621875 22:17167782-17167804 CCCCCAGGGCCAGTTGCGCCAGG + Intergenic
1180622136 22:17169229-17169251 GCCACAGGGGCAGCAGCCAGTGG - Intergenic
1180975336 22:19844970-19844992 TCCCCTGGGGCTGGTGCCCCTGG + Intronic
1181179035 22:21054522-21054544 TCCCCAGGGGCAGCTCCCTGTGG + Intronic
1181557189 22:23677935-23677957 GATGCAGGGGCAGCTGCCCAGGG - Intergenic
1181895828 22:26106623-26106645 GCCCCAGGGGCAACCACACCAGG + Intergenic
1182268840 22:29140121-29140143 GCCTCAGGAGCAGCTGACCCAGG - Intronic
1182461350 22:30485998-30486020 GCACCAGCGGCAGCTGACCTGGG + Intergenic
1182520250 22:30880996-30881018 TCCCCAGGTGGGGCTGCCCCAGG + Intronic
1183201288 22:36387394-36387416 GTCCCAGGGGCCGCGGCTCCCGG + Intronic
1183489976 22:38110977-38110999 GACCCAGCAGCAGCAGCCCCTGG + Intergenic
1183942175 22:41302040-41302062 TCCCCAGCGCCAGGTGCCCCCGG - Intronic
1184470370 22:44692424-44692446 GCCCCAGGAGGAGGAGCCCCCGG - Intronic
1184599246 22:45532858-45532880 CCCCCAGGGGCTGCTGCTTCAGG - Intronic
1184641713 22:45876495-45876517 GCCACAGAGGCAGCTTCTCCGGG + Intergenic
1184652688 22:45926334-45926356 GCCGCAGGGGCCGCTCCTCCAGG + Intronic
1184670364 22:46009121-46009143 GCCTCAGTGCCAGCTCCCCCAGG + Intergenic
1184759849 22:46537869-46537891 GCCCCACGGGTAGCGGCCACCGG - Intergenic
1184892562 22:47388920-47388942 GCCCCCAGGGCAGCAGGCCCGGG + Intergenic
1185222956 22:49638121-49638143 GCCTGCTGGGCAGCTGCCCCGGG + Intronic
1185244458 22:49765754-49765776 GCCTCAGGTGCAGCTGCTACAGG - Intergenic
1185244480 22:49765825-49765847 GCCTCAGGTGCAGCTGCTACAGG - Intergenic
1185244502 22:49765896-49765918 GCCTCAGGTGCAGCTGCTACAGG - Intergenic
1185244545 22:49766038-49766060 GCCTCAGGTGCAGCTGCTACAGG - Intergenic
1185275255 22:49947878-49947900 GCCCCAGGGTCCACTGGCCCCGG - Intergenic
1185366347 22:50438696-50438718 GCCGGTGGGGCACCTGCCCCAGG - Exonic
1185398218 22:50603394-50603416 GGCTCAGAGGCACCTGCCCCCGG + Exonic
950004239 3:9681301-9681323 GCCTGAGGGACAGCAGCCCCAGG - Intronic
950179555 3:10901491-10901513 GCCCCAGGGCCGGCTGCCCAGGG + Intronic
950425694 3:12923745-12923767 GCTCCAGGGGCTGCTGCTCCCGG + Intronic
950661986 3:14472336-14472358 CCCACAGGGGCAGTCGCCCCAGG - Intronic
950876407 3:16278799-16278821 GCCCCTGGGGCAGATGCCTTTGG + Intronic
950876412 3:16278802-16278824 TCCCCAAAGGCATCTGCCCCAGG - Intronic
952334328 3:32391857-32391879 GGCCCCTGGGCAGCTGCCCGGGG + Exonic
952966270 3:38623015-38623037 TCCCCAGGGGTAGCAGGCCCTGG - Intronic
952967116 3:38628260-38628282 TCCCCCAGGACAGCTGCCCCAGG - Intronic
953419861 3:42746181-42746203 GTCCCAAGGGCAGCTCTCCCTGG + Intronic
954675723 3:52314349-52314371 GCTCCAGGAGCAGCGGCCCAAGG - Intergenic
954782542 3:53072055-53072077 GTCCTAGAGGCAGCTGCTCCTGG + Intronic
955002262 3:54938356-54938378 GCCCCAGGGGCTGCTGAGCAAGG - Intronic
956793665 3:72699786-72699808 GCCCCAGGGGCTGCTTCCAGAGG - Intergenic
958256610 3:91332402-91332424 GCCTCAGGTGGAGCTGCCCAAGG + Intergenic
961099421 3:124185949-124185971 GACCCAGGGGCAGATACCACAGG - Intronic
962318104 3:134371193-134371215 GCCCCAGGGCCAGGAGCACCAGG - Exonic
962830685 3:139136588-139136610 GCTCTAGGGACAGCTGCCCTGGG - Intronic
965511525 3:169573084-169573106 GCCCCAGGGGCAGCCTAGCCAGG + Intronic
965561898 3:170069894-170069916 GCCCCAGGAGAAACCGCCCCTGG - Intronic
968485374 4:858434-858456 GCCCCAGTGCCGGCTGCCCAGGG + Intronic
968690485 4:1987457-1987479 GCCCCACGGGCAGCTGAGCACGG + Intronic
968698594 4:2044232-2044254 GCCCCCAGAGCAGCTGCCCCAGG + Intergenic
968710026 4:2107788-2107810 GCCCCAGCGGCAGTTTTCCCTGG - Intronic
968818164 4:2832417-2832439 GCGCCAGGGGAAGATGCCCCAGG + Intronic
968818166 4:2832420-2832442 GGCCCTGGGGCATCTTCCCCTGG - Intronic
968881578 4:3302939-3302961 GACCCCGGGGCAGCTGGCCCTGG + Intronic
968881581 4:3302942-3302964 CTCCCAGGGCCAGCTGCCCCGGG - Intronic
968933037 4:3593378-3593400 GACTCAGTGGCATCTGCCCCAGG + Intergenic
969112560 4:4852827-4852849 GACCCAGGAGCAGTGGCCCCAGG - Intergenic
969476664 4:7426019-7426041 GCCCCTGGGTCTTCTGCCCCGGG + Intronic
969681287 4:8644839-8644861 GCCTCCGGGGGTGCTGCCCCAGG - Intergenic
969715721 4:8867352-8867374 GGCCTGAGGGCAGCTGCCCCGGG + Exonic
970609122 4:17709251-17709273 CCCGCAGGGCCGGCTGCCCCAGG - Exonic
973373298 4:49270746-49270768 TGCCCAGGGGCGGCTGCACCGGG - Intergenic
973387707 4:49524462-49524484 TGCCCAGGGGCGGCTGCACCGGG + Intergenic
978505860 4:109455141-109455163 GCCAAAGGGGCAGCTCCCCTTGG - Intronic
981920397 4:150079119-150079141 GCCCGAGCTGCTGCTGCCCCCGG - Exonic
982129237 4:152212481-152212503 ACCCCAGGGGCCACTGCCCAGGG + Intergenic
984490674 4:180431034-180431056 GCCCCAGGGGCAGCTCTGCAAGG - Intergenic
984766469 4:183404152-183404174 GCCCCCAGTGCAGCTGCCCTGGG + Intergenic
985203089 4:187505137-187505159 GCCCCAGAGGCATCTGCCCCCGG + Intergenic
985553980 5:547186-547208 GCCTCAGGAGCAGCTGCCCAAGG + Intergenic
985632037 5:1018805-1018827 GCCTCTGGGGCGGCTTCCCCTGG - Intronic
985720134 5:1484632-1484654 GCCCTAGGGACAGATGCTCCTGG - Intronic
986058263 5:4161341-4161363 GCAGCAGGTGCAGCTTCCCCAGG + Intergenic
988417700 5:30966860-30966882 GCCCCAGGGTCAGCTGACTGAGG - Intergenic
989101815 5:37830429-37830451 GAGCCAGGGGCAGCTGACCCAGG + Intronic
989101818 5:37830432-37830454 GCCCCTGGGTCAGCTGCCCCTGG - Intronic
990456583 5:55994876-55994898 GCCCCCGGTTCAGCTGCGCCGGG + Exonic
990699432 5:58459800-58459822 GTCCCAGGCGCAAGTGCCCCCGG - Exonic
992111543 5:73498717-73498739 GAGCCAGGGGCGGCTGCCCTGGG + Exonic
992111546 5:73498720-73498742 GCCCCCAGGGCAGCCGCCCCTGG - Exonic
992871234 5:81007506-81007528 GCCCTATTGTCAGCTGCCCCGGG + Intronic
994197249 5:96935145-96935167 GCCCCAGTGGTAGCACCCCCGGG + Intronic
994853904 5:105091602-105091624 GCTCCAGGGCCAGCAGCCCCTGG + Intergenic
995491073 5:112692159-112692181 TCCCCATGGGGAGCTTCCCCTGG + Intergenic
995840410 5:116438507-116438529 GCCCTTGGGGCAGCAGTCCCTGG - Intergenic
996086335 5:119309446-119309468 GTCACAGGGGCAGCTGCCACAGG + Intronic
997209661 5:132069912-132069934 GGGCAAGGGGCAGCTGTCCCTGG + Intergenic
997698079 5:135877400-135877422 GCACCAGGGCCAGCTGCCCTGGG + Intronic
997741496 5:136258804-136258826 CCCCCAGGGGCTACTGTCCCAGG + Intronic
997891772 5:137683294-137683316 TTCCCAGGGCCAGCAGCCCCAGG + Intronic
998106533 5:139472585-139472607 GCCCCAGAGGCAGCTTCCGGAGG + Intergenic
999727239 5:154446653-154446675 GCCCCAGCTGCCGCCGCCCCGGG + Exonic
999772346 5:154785154-154785176 GCCCCAGGGCAAGTTTCCCCAGG - Intronic
999791248 5:154941245-154941267 ACCCCAAGGCCAGCTTCCCCCGG - Exonic
1000041417 5:157487696-157487718 TCCCAAGGGGCAGGTGCCTCTGG - Intronic
1000279933 5:159773558-159773580 GCCCCGGGCGCAGCCGCCCTTGG - Intergenic
1001065261 5:168530416-168530438 GCCTCAAGAGCAGCTGACCCTGG + Exonic
1001380625 5:171304281-171304303 GCCCTAGGGTCAGCTTCCTCAGG + Intergenic
1002183734 5:177444330-177444352 GCCCAAGGGGGAGCTGGCCAGGG - Intergenic
1002224957 5:177713845-177713867 GCCCGAGGAGCAGCTTCCGCAGG + Intronic
1002306431 5:178286506-178286528 GCCCCAGGGACAGCAGCCCCGGG + Intronic
1002530874 5:179844125-179844147 GCCTCAGGCCCACCTGCCCCAGG - Intronic
1002898769 6:1393784-1393806 GCCCCAGAGGCTGCTGGACCGGG - Intronic
1002926402 6:1608170-1608192 GGCCAGGAGGCAGCTGCCCCGGG + Intergenic
1003557282 6:7151430-7151452 CCCCCAGGAGCAGCAGGCCCTGG + Intronic
1006171553 6:32096170-32096192 GCAGCACGCGCAGCTGCCCCGGG - Intronic
1006276152 6:33007064-33007086 TCCCCAGGTGCAGAGGCCCCGGG - Exonic
1006445889 6:34079653-34079675 GCCCCAAGGTCAGCTGCTCTGGG - Intronic
1006683268 6:35812406-35812428 GCCCGTGGGGCAGCTGTGCCTGG + Intronic
1006736592 6:36277930-36277952 GCCACAGGGGCAGCTGCTGGTGG - Intronic
1006820052 6:36885975-36885997 GCCTCGGGGACAGCTGCCGCCGG - Exonic
1006827905 6:36949528-36949550 GACCCCTGGGCAGCTGTCCCAGG - Intronic
1007075067 6:39060989-39061011 GCCCCAGTGTCACCTGTCCCTGG - Intronic
1007139075 6:39553828-39553850 GCCACAGGCACTGCTGCCCCTGG + Intronic
1007342537 6:41200769-41200791 GCCCCAGGCGAAGCTAACCCAGG - Intronic
1007491739 6:42228506-42228528 GGCGCCGGGGCTGCTGCCCCTGG - Exonic
1007785292 6:44276271-44276293 GCGCCACAGGCAGCTGCGCCGGG - Exonic
1007810321 6:44480945-44480967 GCCCCGGGGCAAGCTGACCCTGG - Intergenic
1009940478 6:70283001-70283023 GCCCCAACAGCAGCAGCCCCAGG + Intronic
1010042920 6:71407719-71407741 TCCCCAGGGGCTCCTGCTCCAGG + Intergenic
1012254492 6:97016312-97016334 GCCACAGGGGTGGCTGCCCAAGG + Intronic
1012872919 6:104693211-104693233 GCTCCATGGCCAGCTGCCTCTGG - Intergenic
1013016306 6:106163662-106163684 ACCCCTGGGGCTGCTGCCCAAGG + Intergenic
1015479930 6:133697924-133697946 GCTCCAGAGGCATCTGCTCCTGG - Intergenic
1017820846 6:158048214-158048236 GCCCCGGGGGCAGCTCTCCCAGG + Intronic
1017914374 6:158819676-158819698 GGCCCTGGGGCGGCTGCACCTGG + Intergenic
1017914376 6:158819679-158819701 GGGCCAGGTGCAGCCGCCCCAGG - Intergenic
1018748411 6:166780451-166780473 GCCCCAGGTCCAGGTGCCGCAGG - Intronic
1018953771 6:168394686-168394708 GCCCCAGGTCCAGGTGCCACAGG - Intergenic
1018974500 6:168554885-168554907 GACCCAGCAGCAGATGCCCCCGG - Intronic
1019232919 6:170584147-170584169 GCCCCAGGAGCACCTTCTCCCGG - Intronic
1019323065 7:424415-424437 GCCCCATGGGCAGCCGGCACTGG + Intergenic
1019430414 7:996502-996524 GGCCCCGGGGCAGCAGCACCTGG + Intergenic
1019430417 7:996505-996527 CACCCAGGTGCTGCTGCCCCGGG - Intergenic
1019529043 7:1494563-1494585 GCCCCAGCCGCAGCCTCCCCCGG - Intronic
1019903688 7:4044227-4044249 GTCCACTGGGCAGCTGCCCCTGG + Intronic
1020017306 7:4838496-4838518 TCCCCTGGGGCTGCAGCCCCAGG + Intronic
1020116559 7:5479620-5479642 GCCGCAGGACCAGCTGCCCACGG - Intronic
1021867310 7:24971094-24971116 GCCCCAGAGGCAGGTACCACAGG + Intronic
1021992683 7:26152756-26152778 GCCCGAGGGCCAGCTGCTCCGGG + Exonic
1022837456 7:34131444-34131466 GCGGCAGAGGCGGCTGCCCCTGG - Intronic
1023793532 7:43772227-43772249 GCCACATGGGCACCTGCCCTAGG - Intronic
1025192198 7:56904304-56904326 GCCCCAGGGGCAGCTCAGACAGG - Intergenic
1025679752 7:63672626-63672648 GCCCCAGGGGCAGCTCAGACAGG + Intergenic
1027172012 7:75879193-75879215 GCGCCAGGGGCTGCTGCAGCAGG - Exonic
1028405996 7:90474621-90474643 GCAGCAGAGGCAACTGCCCCAGG + Intronic
1028477085 7:91264805-91264827 GCCGCAGGGGGAGCCGCCGCCGG + Exonic
1028481809 7:91314346-91314368 GCCCTAGGGGCAGCTGGATCTGG - Intergenic
1029552396 7:101244401-101244423 GCTCCCGGAGCAGCTGACCCCGG + Intronic
1031134743 7:117873086-117873108 GCCCCACGGGAAGCGGCCCCGGG - Intronic
1031685170 7:124724577-124724599 GACCCAGCTGCATCTGCCCCTGG - Intergenic
1032398210 7:131605945-131605967 TCCCCAGTGGGAGCAGCCCCTGG + Intergenic
1032466622 7:132149998-132150020 GCCCCAGGGACTGGAGCCCCAGG - Intronic
1034225477 7:149477669-149477691 GCTCCAGGAGCAGCAGGCCCTGG - Exonic
1035113802 7:156506129-156506151 ACCCGAGGGGCAGCTGCCTGCGG - Intergenic
1035255111 7:157621069-157621091 GCCCCGGGGGCAGGTGGCCAGGG - Intronic
1035689209 8:1548821-1548843 GCCCCGCCGACAGCTGCCCCGGG + Exonic
1036528401 8:9556438-9556460 GTCCCAGGTCCTGCTGCCCCAGG - Exonic
1036683277 8:10891679-10891701 GACCTAGGGACACCTGCCCCAGG - Intergenic
1037077051 8:14733187-14733209 GCCCCAGGGCCAGGTACCCCAGG + Intronic
1037287718 8:17318791-17318813 CCCCCAGGGACAGCTGACACAGG + Intronic
1037471475 8:19215504-19215526 GCCCCATGGGCAGTTTCTCCAGG - Intergenic
1037879452 8:22565846-22565868 GGCCCCGGAGCAGCGGCCCCCGG + Exonic
1039793180 8:40891549-40891571 GCCTCAGGGGCAGAGGGCCCAGG - Intronic
1040279218 8:46029587-46029609 GCTCCAGTGGCAGCTGCCAAGGG - Intergenic
1040850845 8:51899127-51899149 GGCACAGGGGCAGCTCCCCGCGG + Intronic
1041196595 8:55407557-55407579 GCCCTCGGGTCAGATGCCCCGGG + Intronic
1041839204 8:62249134-62249156 GCCCCGAGGGCCCCTGCCCCAGG + Intronic
1042532665 8:69832082-69832104 GCCACAGGGGCCGCCGACCCCGG + Exonic
1043026467 8:75076464-75076486 GCCACAGGGGCAGCTGACATTGG - Intergenic
1044533840 8:93337742-93337764 GCCCCAGAGGCAGCCCCACCTGG + Intergenic
1045840290 8:106572014-106572036 GCCACAGGGGCAGCAATCCCAGG - Intronic
1048265539 8:132982259-132982281 GCTCCCGGGTCAGCAGCCCCAGG - Intronic
1048994842 8:139787988-139788010 GCCACAGGGTCAGATGCCCGCGG - Intronic
1049000244 8:139821343-139821365 GGCCCAGGGGCTGCTCTCCCAGG + Intronic
1049255448 8:141611291-141611313 GCCCCAGAGCCAACGGCCCCTGG - Intergenic
1049399473 8:142418536-142418558 GCCCCAGGGACAGCTGGTTCTGG - Intergenic
1049513637 8:143042493-143042515 GCCCCAGGAGCACCTCCCCAAGG + Intronic
1049573302 8:143379472-143379494 GCGCCAGGCGCAGCTGGGCCAGG - Exonic
1049646414 8:143737850-143737872 GGCCCAGGAGCAGCTGCTGCTGG - Intergenic
1049663938 8:143834833-143834855 GCCCAGGGAGCAGCTGCCCCAGG + Exonic
1049790817 8:144472063-144472085 GCCCCAGTGGGAGAGGCCCCAGG + Intronic
1053142469 9:35690231-35690253 GACCCAGTGGCAGCTGCGGCTGG + Exonic
1053142473 9:35690234-35690256 GCCCCAGCCGCAGCTGCCACTGG - Exonic
1053313989 9:37036747-37036769 GCCCAAGGGGCGGCTCCCCTCGG + Intergenic
1053503497 9:38621243-38621265 GCCACAGGGACATCTGGCCCCGG + Intergenic
1053752415 9:41269556-41269578 GCCACAGGGACACCTGGCCCTGG + Intergenic
1054257943 9:62833888-62833910 GCCACAGGGACACCTGGCCCTGG + Intergenic
1054391210 9:64620673-64620695 GCCCCAGGGTCAGTGGACCCTGG + Intergenic
1054457092 9:65438599-65438621 GACTCAGTGGCATCTGCCCCAGG - Intergenic
1054766836 9:69049077-69049099 GCCCCAAGTCCAGCTGCCTCTGG + Intronic
1055701944 9:78954344-78954366 ACCCCAGGGACAGCTTCCCCCGG + Intergenic
1055757205 9:79570528-79570550 GCCCCAGGGGCAGATGCTGGAGG - Intergenic
1055987082 9:82063087-82063109 GGCCCAGAGTCACCTGCCCCAGG + Intergenic
1056787548 9:89603953-89603975 GCTCCAGGGGCTGCAGCCGCGGG + Intergenic
1057306615 9:93916172-93916194 GACCCAGCTGCAGCTTCCCCAGG - Intergenic
1057684815 9:97222197-97222219 GCCACAGGGACATCTGGCCCTGG + Intergenic
1057801911 9:98195947-98195969 GCCCCAGGGGCAGCAACAGCAGG + Intergenic
1059277507 9:113108763-113108785 GACCCGGGGCCAGCAGCCCCAGG + Intergenic
1059278744 9:113115788-113115810 GACCCGGGGCCAGCAGCCCCAGG - Intergenic
1059751993 9:117256309-117256331 GCACCAGCTGCAGATGCCCCAGG - Intronic
1060152905 9:121299978-121300000 GCCCCAGGGGCGGGTGCCCGAGG + Exonic
1060521853 9:124298486-124298508 TCCCCAGGGGCAGGAGCCCCCGG - Intronic
1060629512 9:125143308-125143330 GGCCCAGGGGCAGCGGCTCGGGG - Intronic
1060883593 9:127135464-127135486 GCCACAGGGGCACATGTCCCTGG - Intronic
1060983881 9:127808831-127808853 GCTCCTGTGGCAGCTGCCCCTGG + Exonic
1060983882 9:127808834-127808856 GTGCCAGGGGCAGCTGCCACAGG - Exonic
1061093970 9:128443689-128443711 GCCCAAGGTGCAGCTGGCCCAGG + Intergenic
1061301661 9:129709206-129709228 GACCCAGCAGGAGCTGCCCCTGG - Intronic
1061392808 9:130327223-130327245 GGCCATGGGGCAGCTCCCCCAGG - Intronic
1061662847 9:132141738-132141760 CCCGCAGGGGCAGGCGCCCCAGG + Intergenic
1062076876 9:134594459-134594481 CCCCCAGCAGCACCTGCCCCAGG + Intergenic
1062274970 9:135726256-135726278 GGCACAGGGCCAGCAGCCCCCGG + Intronic
1062312321 9:135945519-135945541 ACCACAGGGGGAACTGCCCCCGG + Intronic
1062320445 9:135988194-135988216 GCCTCAGGGGCTGCTCCCCGGGG + Intergenic
1062340056 9:136090198-136090220 GCCCCCGAGGCAGATGCCCAGGG + Intronic
1062402332 9:136378097-136378119 GGCGCAGGGGCAGCTTCTCCAGG + Exonic
1062451185 9:136616450-136616472 ACCCCAGGGGCACATGCTCCAGG - Intergenic
1062451562 9:136617868-136617890 GCCCCGGCGGCTGCTGCCCCTGG + Intergenic
1062451566 9:136617871-136617893 GTCCCAGGGGCAGCAGCCGCCGG - Intergenic
1062520544 9:136955935-136955957 GGCCCTGGTGCAGATGCCCCAGG + Intronic
1062615439 9:137393983-137394005 GCCCCAGTGGGAGCTGTCCGGGG - Intronic
1062631614 9:137465517-137465539 GCCCCAGGGACAGCGTCCTCGGG - Intronic
1203552202 Un_KI270743v1:172280-172302 TGCCCAGGGGCGGCTGCACCGGG + Intergenic
1185520477 X:734762-734784 GCTCGTGGGGGAGCTGCCCCGGG + Intergenic
1185615547 X:1419595-1419617 CCCCCAGTGGCACCTACCCCGGG + Intronic
1186643556 X:11482630-11482652 GCCCCAAGGACATCTGCCACAGG - Intronic
1189422389 X:40867642-40867664 GCCCCAGGAGAAGCTGCCATTGG - Intergenic
1192174066 X:68874933-68874955 GCCCCTGGGGCTTCTTCCCCTGG + Intergenic
1195802682 X:108731638-108731660 ACTCCAGGGGCAGCTTACCCTGG - Intronic
1196855497 X:119979140-119979162 GCACCAGAGGCAGCTGCTCAAGG - Intergenic
1197262634 X:124334114-124334136 GCCCCAGGGGACGGTCCCCCAGG + Intronic
1199201504 X:145095193-145095215 ACACCAGTGGCAGCTGCCTCAGG + Intergenic
1199201506 X:145095196-145095218 GGCCCTGAGGCAGCTGCCACTGG - Intergenic
1199608144 X:149592920-149592942 GGCCCAGGGACAGCGGCCACCGG + Exonic
1199630976 X:149776440-149776462 GGCCCAGGGACAGCGGCCACCGG - Exonic
1200099906 X:153685198-153685220 TCCCCAGCAGCTGCTGCCCCCGG + Intronic
1200233508 X:154457900-154457922 GCCCCGGTGGCAGGTGACCCCGG + Intergenic
1200266667 X:154649809-154649831 GCCCCAGGGGAAGCAGCACCGGG - Intergenic
1200277784 X:154750894-154750916 GCCCCGCGGGCGGGTGCCCCGGG + Intronic
1201303052 Y:12526823-12526845 GCCACAGGGCCACCTGCTCCAGG - Intergenic