ID: 1175424069

View in Genome Browser
Species Human (GRCh38)
Location 20:58853368-58853390
Sequence GGGGCAGCTGCCCCCGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 358}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424051_1175424069 26 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424058_1175424069 4 Left 1175424058 20:58853341-58853363 CCCGAGCAACCACCTTTGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424059_1175424069 3 Left 1175424059 20:58853342-58853364 CCGAGCAACCACCTTTGGAGGCC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424052_1175424069 25 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424064_1175424069 -8 Left 1175424064 20:58853353-58853375 CCTTTGGAGGCCCCAGGGGCAGC 0: 1
1: 0
2: 2
3: 29
4: 298
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424053_1175424069 24 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424063_1175424069 -5 Left 1175424063 20:58853350-58853372 CCACCTTTGGAGGCCCCAGGGGC 0: 1
1: 0
2: 8
3: 46
4: 333
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424055_1175424069 22 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358
1175424054_1175424069 23 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG 0: 1
1: 0
2: 0
3: 48
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424069 Original CRISPR GGGGCAGCTGCCCCCGGTGC TGG Exonic
900105171 1:978070-978092 GGGGAAGCGGCTCCCGGGGCAGG - Intronic
900179383 1:1304605-1304627 AGGGCAGCTGCTCTCGGTCCTGG + Intronic
900366248 1:2313050-2313072 GGAGCAGGTGGCCCCGCTGCGGG + Intergenic
900371874 1:2335837-2335859 GGGGCAGCTGCGCGCTGGGCTGG - Intronic
900548399 1:3241431-3241453 GGGGCAGCTGCCACAGCTGCTGG - Intronic
900641587 1:3690309-3690331 GGCGCACCTGCCCCCTGCGCGGG - Intronic
900700871 1:4047941-4047963 GGGGCAGCTCCCTCTGTTGCTGG + Intergenic
900953750 1:5874470-5874492 AGGGCAGCTGGCCATGGTGCAGG - Exonic
901051911 1:6429590-6429612 GGGGCAGGTGCCCCTGATGGCGG + Intronic
901237541 1:7675585-7675607 TGGGCTGTGGCCCCCGGTGCTGG + Intronic
901632329 1:10653926-10653948 GGGGCTGCCGCCCTCGCTGCTGG - Exonic
901771288 1:11531629-11531651 GGGACAGCTGCCCCGGGAGCAGG - Exonic
902241828 1:15094871-15094893 GGCGCAGCTTGCGCCGGTGCAGG - Exonic
902482324 1:16718424-16718446 GGGGCAGGTGCCCCTGATGGCGG - Intergenic
902878108 1:19353091-19353113 AGGGCAGCTGCCGCTGCTGCCGG + Intronic
902925013 1:19690287-19690309 AGGGCAGCTGCCCCACGTGATGG + Intronic
902943075 1:19814481-19814503 CCAGCAGCTGCCCCGGGTGCTGG + Exonic
902988728 1:20171404-20171426 GAGGCAGGTCCTCCCGGTGCAGG + Intronic
903275055 1:22216287-22216309 GGGGAAGCTGGCCCTGGTGCGGG + Intergenic
903554069 1:24180638-24180660 GGGACAGCTGCACCCAGTGTGGG - Intronic
903788438 1:25876101-25876123 GGGGAAGCTGCCCGAGGGGCGGG - Intergenic
904376730 1:30086365-30086387 AGGCCAGCGGCCCCCGGAGCAGG - Intergenic
904625668 1:31800539-31800561 GGGGCAGCTGCCACCAAAGCTGG - Exonic
904756665 1:32771880-32771902 GGGGCCGATGGCCCCAGTGCTGG - Exonic
904772163 1:32886523-32886545 GGGGCAGCTCCAGCCGGGGCCGG + Intronic
905870277 1:41399595-41399617 GAGGGAGCTGCCTCCGGTGTTGG - Intergenic
906380194 1:45327648-45327670 GGGGGAGCTGCCGGGGGTGCAGG - Exonic
906563525 1:46778784-46778806 GGGCCGGCTGCTCCCAGTGCGGG + Intronic
906640831 1:47439405-47439427 GGGGCAGCACCCCCGGGCGCCGG + Exonic
906709045 1:47915788-47915810 GTGGCTGCTGCTCCCTGTGCCGG + Intronic
909443642 1:75724596-75724618 GTGGCAGCGGTCCCCGGCGCCGG - Intronic
913972270 1:143424065-143424087 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
914066652 1:144249678-144249700 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
914112501 1:144716676-144716698 GGGGCAGCTGCCCCCCCAGCGGG + Intergenic
914704375 1:150159190-150159212 GGGACAGCTGCCCCGGGTTGGGG - Exonic
914704381 1:150159199-150159221 GGGGCAGCTGTCCCGGATCCAGG + Exonic
914902284 1:151717097-151717119 GCTGGAGCTGTCCCCGGTGCTGG + Intronic
915010365 1:152679628-152679650 GGAGCAGCTGCTCCCAGAGCAGG + Intergenic
915039688 1:152958362-152958384 GGGGCACCTGCCCCCTGGGATGG - Intergenic
915246312 1:154558511-154558533 GGGGCAGCAGCAGCCGGGGCCGG - Exonic
915246462 1:154559039-154559061 GGGGAAGCGGCGCCCGGGGCAGG - Intergenic
915348828 1:155212198-155212220 GGAGAAGTTGCTCCCGGTGCTGG + Exonic
915473079 1:156137283-156137305 GGGGCAGCTGGCTCCGATGTTGG - Intronic
917329672 1:173868457-173868479 GGGCGAGGTGACCCCGGTGCAGG - Intronic
917969190 1:180196426-180196448 CGGGCAGCTGACCCAGCTGCAGG - Exonic
918058990 1:181045916-181045938 GGGCCGGCTGCCCCCAGTGCAGG - Intronic
922794461 1:228333235-228333257 GGGCCAGCTGCCCCAGGTGGTGG + Exonic
922802320 1:228370137-228370159 TGGTCAGCTGCCCCCGGGGCAGG - Intronic
923085607 1:230701547-230701569 AGGGCAGCTGCCGCCACTGCCGG + Intergenic
923092240 1:230749462-230749484 TGGGCAGCTGCCCAGGCTGCAGG + Intronic
923499278 1:234550982-234551004 GGGGCAGCTGGGCAAGGTGCAGG - Intergenic
923551799 1:234970146-234970168 GGGGCAGCTGCGGCCGCTGCTGG - Intergenic
923724130 1:236491784-236491806 GGGGCAGCAGCCACCGGCCCAGG - Intergenic
1062981078 10:1723631-1723653 AGGGCTGCTGTCCCCTGTGCAGG - Intronic
1063557844 10:7097444-7097466 GGGGCATCTTCCACCCGTGCTGG - Intergenic
1064323742 10:14329984-14330006 GCAGCAGCAGCCCACGGTGCAGG + Intronic
1064644246 10:17444627-17444649 GGGGCAGCTGGCCCAGGTAGAGG - Intronic
1065019989 10:21495848-21495870 GGGGCAGCAGCGCCCCCTGCAGG - Exonic
1065748190 10:28860963-28860985 GGGGCTGCTGCTCCTGGTGTAGG - Intronic
1067453651 10:46397925-46397947 GGGGCGGCTGCCCCAGGTTGGGG - Intergenic
1067583578 10:47461821-47461843 GGGGCGGCTGCCCCAGGTTGGGG + Intronic
1067633581 10:47987169-47987191 GGGGCGGCTGCCCCAGGTTGGGG + Intergenic
1067726812 10:48776785-48776807 TGGCCAGCTGCCCCAGATGCTGG + Exonic
1068204180 10:53827453-53827475 GGGGGCGCTGCCACTGGTGCAGG + Exonic
1068969654 10:62947884-62947906 GGGGCAGCTGGCCCGGCTGGGGG - Intergenic
1069634323 10:69916256-69916278 GGGGCAGCTGGGCCGGGAGCAGG + Intronic
1069761803 10:70816234-70816256 GGGGCGGCTGCGGCCGGGGCGGG + Intronic
1069884576 10:71615693-71615715 AGGGCTCCTGCCCCCGGTGGTGG + Intronic
1070998368 10:80806748-80806770 GAGGCTGGTGCCGCCGGTGCAGG + Intergenic
1071562568 10:86655404-86655426 GGGGATGCTGGCCCAGGTGCTGG + Intronic
1073258495 10:102171086-102171108 GGGGCAGCTGACCCATGTGGTGG + Intergenic
1073428733 10:103472175-103472197 GGAGCACCTGCCCCCGCTGCAGG + Intergenic
1073512489 10:104051565-104051587 GGGACATCTGGCCCCGGTGCAGG + Intronic
1075778754 10:125003824-125003846 GGGGCAGCTGGTGCCGGTGCAGG - Intronic
1076120728 10:127934883-127934905 GGGGGCGCTGCCCCCAGAGCCGG - Intronic
1076359270 10:129875573-129875595 AGGGAAGCTGCCCCCGATGAGGG - Intronic
1076657872 10:132036633-132036655 GGGGCTCCTGCCCGCGGTGACGG + Intergenic
1076882874 10:133248082-133248104 GGGGCTGCTGGCCCGGGAGCTGG + Intergenic
1077031899 11:472137-472159 AGGGAAGCTGCTCCCGGTGCAGG - Intronic
1077115794 11:884111-884133 TGAGCAGCTGGCCCCCGTGCTGG - Exonic
1077147409 11:1052346-1052368 GGGGCAGGTGCCCCAGGAGGGGG - Intergenic
1077378054 11:2214854-2214876 GGAGCAGCTGCCAGCGGGGCAGG - Intergenic
1079101417 11:17544396-17544418 GGGCCAGCCGCCCTCGGAGCTGG + Intronic
1079104722 11:17563289-17563311 GGGGCAGCTGCCCTGGCTGTGGG - Intronic
1080886851 11:36376005-36376027 GGGGCAGCTGGGCCGGGGGCGGG + Exonic
1083130755 11:60622301-60622323 GGGGCGGCTGGCCCCGTCGCGGG - Intergenic
1083282686 11:61636998-61637020 GTGCCAGCTGCCACCCGTGCTGG + Intergenic
1083476994 11:62921310-62921332 GGGGGAGCTGCGCCCTGTGCTGG + Exonic
1084010757 11:66347131-66347153 GGCGCAGCTGGCCACGGTGCTGG - Exonic
1084204410 11:67583677-67583699 GGTGCAGCGGCCGCCGGGGCTGG + Exonic
1084216407 11:67649028-67649050 GTGACAGCTGCCCCCAGGGCTGG - Intronic
1084554652 11:69868601-69868623 GGGGCGGCTGCCCGGGGTGGGGG - Intergenic
1084556656 11:69879819-69879841 GGGGCAGCTGCCCGGGGAGGAGG - Intergenic
1084556661 11:69879828-69879850 CGGGCAGCTGCCCCCACTGCTGG + Intergenic
1085505819 11:77058230-77058252 CAGGCAGCAGCCCCAGGTGCCGG + Intergenic
1088653439 11:111977486-111977508 GAGGCAGCTTCCGCCGGGGCCGG + Intronic
1089177409 11:116558566-116558588 AGGGCAGGTGCCCCAGCTGCCGG + Intergenic
1089499912 11:118925798-118925820 GGTGCAGCGGCCCCGGGTCCGGG + Intronic
1089752821 11:120663372-120663394 GTGGCAGCTGACACTGGTGCTGG + Intronic
1090351539 11:126111406-126111428 TGGGCTGCTGGCCCCGGGGCCGG + Intergenic
1091719435 12:2801850-2801872 GGGGCAGCTGCTTCTGGTGGGGG - Intronic
1091856344 12:3743538-3743560 GGGGGAGGTGTCCACGGTGCAGG + Intronic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1092953335 12:13527683-13527705 GGGGCTGCTGCCTCTGGTGTGGG - Intergenic
1095966252 12:47869066-47869088 GGGGCAGCCCCCCCAGCTGCAGG + Intronic
1097220745 12:57449539-57449561 GGGGCACCTGACCCTGGAGCTGG + Exonic
1098957129 12:76699114-76699136 GGGGCAGCAGACCCCTGTGGTGG + Intergenic
1101718441 12:107331476-107331498 GGGGCAGCTCCCCTCCTTGCAGG - Intronic
1103120602 12:118376703-118376725 GGGGCTGCTGGCCCCGGCCCCGG + Exonic
1103386329 12:120534996-120535018 GGGGCGACTGCCCCTGCTGCTGG + Intronic
1103907335 12:124334522-124334544 GGGGCAGCTGGCCCCAGGGAAGG + Exonic
1104615846 12:130267766-130267788 GGGGCAGCTGCCCCATGAGAAGG + Intergenic
1104768141 12:131343854-131343876 GTGGCAGGTGCCCCAGGGGCAGG + Intergenic
1104785458 12:131445396-131445418 AGGCCAGCTGCCCTGGGTGCTGG - Intergenic
1104894521 12:132155329-132155351 GGGCCAGCAGCCCACGGTGAAGG + Intergenic
1104973395 12:132541438-132541460 TGGGCAGCTGTCCCCGGGGTGGG - Intronic
1105787359 13:23762686-23762708 GGGGCAGCCGCCTCCTGTGCTGG + Intronic
1106208359 13:27620303-27620325 CGGGCAGCCGCCTCAGGTGCGGG - Intronic
1110887204 13:80654962-80654984 CGTGCTGCTGCCCCCGCTGCGGG + Intergenic
1110940315 13:81341049-81341071 GGGCCGGCTGCTCCGGGTGCGGG + Intergenic
1114084481 14:19229424-19229446 GGGGAATCTGCCCCTGGTGCTGG + Intergenic
1114281166 14:21193308-21193330 GGGCCAGCAGCTCCGGGTGCTGG - Intergenic
1114483860 14:23051877-23051899 GAGGCAGCTGAACCCGCTGCTGG + Intronic
1115648833 14:35388729-35388751 GTGCCAGCTGCCACCCGTGCTGG - Intergenic
1117803195 14:59465258-59465280 GCGGCCGCCGCCCCCGGTGCGGG - Exonic
1119692785 14:76690303-76690325 AGGGCAGCTGCCCAGGGTGCTGG - Intergenic
1122143868 14:99677407-99677429 CTGGCAGGTGCCCCCGCTGCTGG + Exonic
1122418270 14:101560643-101560665 GGGTCAGCGGCCGCCGGGGCCGG - Intergenic
1122816188 14:104315317-104315339 GGGGCAGCTGGCCCTGGACCGGG + Intergenic
1122940187 14:104977718-104977740 GGTGCAGGTGCCCCGGGTCCCGG + Intronic
1202902345 14_GL000194v1_random:51026-51048 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1123704708 15:22942767-22942789 GGGGCTGCAGTCCTCGGTGCCGG - Intronic
1124238879 15:28013747-28013769 GGGGCAGCTGTCCTCTGGGCTGG - Intronic
1125514891 15:40312953-40312975 GTGCCAGCTGCCACCTGTGCTGG - Intergenic
1127915259 15:63450154-63450176 GGGGTAGCTGACCCCGCAGCTGG - Intergenic
1128056385 15:64702920-64702942 GGGGCGGATGGCCCCGCTGCGGG + Intronic
1129120753 15:73394972-73394994 GGAGCAGCTGGCCCCAGTTCTGG - Intergenic
1130878485 15:88034233-88034255 GGGGCAGCTGGCCCAGCTGCTGG - Intronic
1131258400 15:90876122-90876144 GGGGCATCTGCTCCCTGTCCGGG - Intronic
1132603582 16:784472-784494 GTGGCAGCTGCCTCCGGTCTGGG + Intergenic
1132603604 16:784544-784566 GTGGCAGCTGCCTCTGGTCCAGG + Intergenic
1132607735 16:800548-800570 GGGGCAGCTGCCCTCGCCCCGGG + Intronic
1132747639 16:1443595-1443617 GCGGGAGCTGCTCCAGGTGCGGG - Exonic
1134849798 16:17470613-17470635 GGAGCAGCCGCCCCCGGCCCCGG - Exonic
1136242214 16:28951392-28951414 GGGGAAGGTGCGCCCGGTCCCGG + Exonic
1136473787 16:30499249-30499271 GCGGCAGCTGCCCTGGGAGCAGG - Intronic
1137836123 16:51594256-51594278 GGGGCTGCTGCCTCTTGTGCAGG + Intergenic
1138350756 16:56345137-56345159 GGGGTAGCTTCTCCCGGTGACGG + Exonic
1138598114 16:58040211-58040233 AGGGCAGGTGGCCCCGGAGCTGG + Intronic
1139160665 16:64504257-64504279 AGGGAAGCTGCCCCCAGTCCTGG + Intergenic
1141428158 16:83956926-83956948 GGGGCAGCCGCGCCCTCTGCTGG - Intronic
1141603022 16:85137615-85137637 GGGGCAGCTTCGCCCGGGACTGG - Intergenic
1142155190 16:88529810-88529832 TGGCCAGCTGGCCCCTGTGCAGG - Intronic
1142290616 16:89192272-89192294 GGGGCGGCTGCCCCGAGTCCCGG - Exonic
1142400574 16:89856193-89856215 GCGGAGGCTGCGCCCGGTGCGGG + Exonic
1142804225 17:2363123-2363145 GGGGCACCTACCCCCAGGGCTGG - Exonic
1142906859 17:3049297-3049319 GCGGCAGCTGTCCCCGGGGTGGG + Intergenic
1143008205 17:3850915-3850937 GAGGCAGCTGACCCTGGTGGGGG + Intergenic
1143431869 17:6893889-6893911 GAAGCAGCTGCCACCGGTGTGGG + Intronic
1143510801 17:7394221-7394243 GAGGCAGCTGCGCCCGGCGCCGG + Exonic
1144464095 17:15482651-15482673 GTGACAGATGCCCCAGGTGCCGG - Intronic
1146371176 17:32266273-32266295 GGAGCGGCTGCCCGCGGCGCCGG + Exonic
1146542814 17:33712209-33712231 GGAGCAGCTGCCTTCTGTGCAGG + Intronic
1146904236 17:36607960-36607982 GAGGCAGCTGGCGCCGGGGCAGG - Exonic
1146935080 17:36808258-36808280 GGGGCAGCTGCGCCCTCCGCGGG - Intergenic
1147559299 17:41499181-41499203 GGGGCAGATGGCCAGGGTGCCGG + Intergenic
1147614935 17:41822148-41822170 GGGGCAGGGGCCCCGGGTGGAGG - Intronic
1148189087 17:45666416-45666438 GGGGAAACTGCCCCTGGTGAGGG + Intergenic
1148218331 17:45845995-45846017 TGGGCAGCCGCACACGGTGCAGG - Exonic
1148747683 17:49927633-49927655 GGGGCAGCTGGGCGGGGTGCAGG - Intergenic
1149296275 17:55265033-55265055 GGAGCAGCGGCCGCCGGCGCGGG + Exonic
1150108605 17:62479130-62479152 CGGGCAGCCGCCGCCGGCGCCGG - Exonic
1151554326 17:74839015-74839037 GCCCCAGATGCCCCCGGTGCAGG + Exonic
1151600820 17:75105077-75105099 GGTGCAGCTGCCCCCAGTGAAGG + Intronic
1152374484 17:79912130-79912152 GGGGCAGGAGCCCCAGGTCCAGG + Intergenic
1152462028 17:80446566-80446588 GGGGCAGCTGGCCCCGGCCAGGG + Intergenic
1152854801 17:82658635-82658657 GCGGCAGGTGCCCACGGAGCAGG - Exonic
1152911995 17:83010238-83010260 GCGGCCGAAGCCCCCGGTGCTGG - Intronic
1153913411 18:9723625-9723647 GGGGCAGCTGCATCTGGTGAGGG + Intronic
1155047514 18:22115781-22115803 GGGGGAGCTGCTCCTGGTTCTGG + Intergenic
1156375604 18:36512563-36512585 GCAGCAGCTGCCCCAGCTGCAGG + Intronic
1156491147 18:37496976-37496998 GAGGCAGCTGGCCCCGGTCCTGG + Intronic
1157176593 18:45457852-45457874 AGAGCAGCTACCCCCGGGGCTGG + Intronic
1157687384 18:49653112-49653134 GGGGCAGCTGCACTGGATGCAGG - Intergenic
1160370510 18:78368905-78368927 GGGGCAGCTGTGGCCGGTGCCGG - Intergenic
1160393898 18:78558324-78558346 GGCGCTGCTGCCCCCGGCCCAGG + Intergenic
1160673083 19:375574-375596 AGGGCAGCAGCCCCCTGGGCGGG - Intronic
1160830521 19:1102766-1102788 TGGGCAGCTGCCCCTGGGGGTGG + Intergenic
1160894478 19:1396198-1396220 GCGCCAGATGCCGCCGGTGCTGG + Intergenic
1160897927 19:1411441-1411463 GGAGCAGCGGCCCCCAGCGCAGG - Intronic
1161063982 19:2228635-2228657 GGCACAGCTGCCCCCAGGGCTGG - Intronic
1161209239 19:3057596-3057618 GGAGCAGCTGCCCGTGGTGGAGG + Intronic
1161266026 19:3365207-3365229 GGGGCAGGTGCCCCAGGCCCAGG - Intronic
1161404649 19:4084607-4084629 GGGACAGCTGCACCCGGGGTGGG - Intergenic
1161486140 19:4536862-4536884 GGGGCACCTGCCCCCGGGCAAGG - Exonic
1161512065 19:4677391-4677413 GGGCCACCTGCCCCTGCTGCCGG - Intronic
1162017267 19:7852368-7852390 GGGCCAGCTGGGCCGGGTGCAGG + Intronic
1162353171 19:10163928-10163950 GGAGCTGTTGGCCCCGGTGCAGG - Intronic
1162353627 19:10166734-10166756 GGAGCTGTTGGCCCCGGTGCAGG - Intronic
1162412504 19:10514981-10515003 GGGGCTGCTGCGGCCGGCGCCGG - Exonic
1163002317 19:14375979-14376001 GTGGGACCTGCCCCCGGTGGGGG + Intergenic
1163415054 19:17181248-17181270 TGGGAAGCTGCCCCGTGTGCTGG - Intronic
1163442659 19:17329484-17329506 GCGGCAGCTGCAGGCGGTGCTGG - Intronic
1163569478 19:18072211-18072233 AGGGCATCTTCCCCAGGTGCAGG + Exonic
1165062339 19:33210987-33211009 GGGGCTGCTGGGCCCGGAGCAGG - Intronic
1165094246 19:33401955-33401977 AGGGCAGCTGGCCCGGGTCCTGG + Intronic
1165721417 19:38082135-38082157 GGGGCAGCGCCCCCGTGTGCCGG - Exonic
1166118979 19:40673631-40673653 GGGGCAGCTGCTGCCTCTGCTGG + Exonic
1166762637 19:45234548-45234570 GGCGCAGCTGGGCCAGGTGCTGG - Intronic
1166789862 19:45392272-45392294 GGGGCTGCTGACACCAGTGCTGG - Exonic
1166894663 19:46016069-46016091 GGTGCAGCCGCCCCCGACGCGGG + Exonic
1167577722 19:50325751-50325773 GGGGGAGCTGTCCGCGGTACTGG - Intronic
1167591998 19:50409188-50409210 GGGGCTGCTGCCCCAGATCCTGG + Exonic
1167721418 19:51182749-51182771 GAGGCAACTGCCCAGGGTGCAGG + Intergenic
1167729232 19:51241125-51241147 GAGGCAACTGCCCAGGGTGCAGG + Intronic
1167763558 19:51464021-51464043 GAGGCAACTGCCCAGGGTGCAGG - Intergenic
1168095016 19:54109540-54109562 GGGGCAGCAGCCACCTGGGCAGG + Intronic
1168336492 19:55600273-55600295 GGGGCGGCGGCGCGCGGTGCCGG - Intronic
1168353177 19:55687859-55687881 GGGGCCCCTGGACCCGGTGCAGG + Intronic
925148156 2:1594784-1594806 GGGGCAGCAGAGCCTGGTGCAGG - Intergenic
925554908 2:5120453-5120475 GGGGCTGTTGCCCCAGGGGCAGG + Intergenic
925770901 2:7282271-7282293 AGGTCAGCTGCCCACTGTGCTGG + Intergenic
926616653 2:15002813-15002835 GGGTCAGCTGCTCCAAGTGCGGG + Intergenic
928366484 2:30706890-30706912 GGGGCACCTGCCCACTGCGCTGG - Intergenic
928850025 2:35734447-35734469 GTGGCAGCTGCCCCTCCTGCTGG - Intergenic
929532894 2:42763539-42763561 GGGGCAGCTGCCCGGGTGGCCGG - Exonic
929780138 2:44952199-44952221 GGGGACGCGGCCCCCGGGGCAGG + Intergenic
931955419 2:67418792-67418814 TGGGCAGCTGTGCCCTGTGCAGG + Intergenic
933980164 2:87542870-87542892 GAGGCAGCTGCCCTGGGGGCAGG + Intergenic
934176963 2:89585002-89585024 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
934287270 2:91659362-91659384 GGGGCAGCTGCCCCCCCAGCGGG - Intergenic
934504325 2:94879378-94879400 GGCCCAGCAGCCCCAGGTGCTGG - Intergenic
934664129 2:96158234-96158256 GTGGGGGCTGCCCCCTGTGCTGG - Intergenic
934953107 2:98592785-98592807 GGGGCCGATGTCCACGGTGCTGG - Intronic
935200097 2:100848963-100848985 GCGGCATCTGCCCCGTGTGCTGG - Intronic
936313663 2:111407921-111407943 GAGGCAGCTGCCCTGGGGGCAGG - Intergenic
937062813 2:118992887-118992909 GGGGCAGGTGCCCCTGTGGCTGG - Intronic
937340742 2:121088967-121088989 AGGCCAGAGGCCCCCGGTGCAGG + Intergenic
938492101 2:131766675-131766697 GGGGAATCTGCCCCTGGTGCTGG - Exonic
938495466 2:131795668-131795690 GGGGAATCTGCCCCTGGTGCTGG + Exonic
939513189 2:143132633-143132655 GCTGTAGCTGCCCCCAGTGCAGG - Intronic
942241229 2:173965073-173965095 GGGGCCGCTGCCGCCGGTCTCGG - Intronic
942591586 2:177552529-177552551 GGGCCAGCTGCACCCGGAACTGG - Exonic
942598709 2:177618467-177618489 GGGCCAGCTGCACCCGGAACTGG - Exonic
943320422 2:186436896-186436918 GGTGCACCTGCCCCCCTTGCTGG + Intergenic
944831048 2:203534775-203534797 GGGCCACCAGCCCCCGGTGCTGG + Intronic
946412390 2:219521829-219521851 GGGCCTCCTGCCCCCAGTGCTGG - Intronic
947850720 2:233285536-233285558 GGGGCAGGAGCCTCCTGTGCTGG + Intronic
948462041 2:238134454-238134476 GGGGCAGCTCCCCCAGAGGCAGG - Intergenic
948471161 2:238180634-238180656 GGGGCAGCGACCCACGCTGCTGG + Intronic
948610775 2:239165284-239165306 GGAGCAGCTGCCCCTGCTGCAGG - Intronic
948610776 2:239165293-239165315 GGGGCAGCTGCTCCTCCTGCTGG + Intronic
948746117 2:240095556-240095578 GGTGCAGGGGCCCCTGGTGCAGG + Intergenic
948782346 2:240329543-240329565 GGGGCAGCAGCCCCTGGCCCTGG + Intergenic
948828217 2:240584544-240584566 TGGGCAGCTGCACCTGGTGAGGG + Intergenic
948863404 2:240763704-240763726 GGGGCCGGTGCCCCCAGAGCTGG + Intronic
949001515 2:241616946-241616968 GGGGGAGCGGCCCCAGGAGCAGG - Intronic
949022675 2:241750305-241750327 GGACCAGCTGCCCCCTGTGTGGG - Intronic
1168806658 20:675724-675746 GGGGCCGCCGCCACCGGTGCCGG - Exonic
1168958978 20:1855337-1855359 GAGGCAGCTGCCCCCGCTCCAGG - Intergenic
1171013860 20:21522785-21522807 GGGGGAGCTGCCCCCTCCGCTGG - Intergenic
1171207043 20:23289372-23289394 GGGGCGACTGTCCCTGGTGCAGG + Intergenic
1172192176 20:33068799-33068821 GGGGCAGCTTCCCCAGGGCCTGG - Exonic
1172693451 20:36805862-36805884 GGTCCAGCTGTCCCCCGTGCAGG + Exonic
1173707768 20:45124987-45125009 GGGGCAGGAGCACACGGTGCTGG - Intergenic
1173836402 20:46128832-46128854 GGCACAGCTGCCCCTGCTGCTGG + Intronic
1174197772 20:48785706-48785728 GGGGCTGCTGGCACCGGTGGAGG - Intronic
1174343875 20:49915427-49915449 GGCGCGGCTGCCGCCGGAGCCGG + Intronic
1174553880 20:51380473-51380495 GGGGCATCTGCCTCTGGTGAGGG + Intergenic
1175424069 20:58853368-58853390 GGGGCAGCTGCCCCCGGTGCTGG + Exonic
1176143092 20:63553719-63553741 GGGGCGGCTTCCCCCGCCGCGGG - Exonic
1176217315 20:63954333-63954355 TGGGCACCTGCCCCCAGAGCTGG - Intronic
1176621713 21:9065793-9065815 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1178407125 21:32334168-32334190 GGGGCAGCAGCCTCCGGTTCTGG + Exonic
1179582201 21:42351118-42351140 GAGGCAGCTGTGCCCTGTGCAGG + Exonic
1179725992 21:43341530-43341552 GTGGCAGCTGCCCGGGGAGCTGG - Intergenic
1179804089 21:43826198-43826220 GGGACAGCTGCTCCCAGGGCAGG - Intergenic
1179889243 21:44327423-44327445 GGGGCTGCTGCCCACTGGGCTGG - Intergenic
1179984742 21:44914066-44914088 AGGGCACCTGCCCCCAGTGTGGG - Intronic
1180181860 21:46121657-46121679 GGGGCAGCTGCCTGAGGAGCAGG + Intronic
1180293491 22:10863778-10863800 GGGGAATCTGCCCCTGGTGCTGG - Intergenic
1180496296 22:15893193-15893215 GGGGAATCTGCCCCTGGTGCTGG - Intergenic
1180857971 22:19060045-19060067 GGGGCAGCTGCCACCGTGGTGGG - Intronic
1183192227 22:36329080-36329102 GGGGCAGCTGCCATTGGTGTTGG - Intronic
1183248188 22:36710020-36710042 GGGGCTGTTGGCCCCGGGGCTGG + Intergenic
1183596821 22:38817920-38817942 GGGGTAGCTGACCCTGATGCTGG + Intergenic
1183604737 22:38861682-38861704 GGGGGACCTGCCCCCCATGCTGG + Exonic
1184090297 22:42289786-42289808 GTGGCAGCTGTGCCCGGGGCAGG - Intronic
1184264085 22:43337510-43337532 GGGGCGGCTGGCCCGGCTGCTGG - Intronic
1184364830 22:44043919-44043941 GGGACAGCTGCCACCACTGCAGG - Intronic
1184523444 22:45008665-45008687 GGTGCCGCGGCCCGCGGTGCTGG - Intronic
1185188648 22:49418654-49418676 GTGGCACCTGCCCCTGGCGCAGG - Intronic
1185252807 22:49814271-49814293 AGGGCAGGAGCCCCCGGTGCAGG + Intronic
950477078 3:13221272-13221294 CAGGCAGCTGCCCCCAGAGCAGG - Intergenic
950589913 3:13929705-13929727 GGGCCAGCTGCCCCTGCTGCTGG + Intergenic
954640123 3:52092902-52092924 GGGGAAGCTGCCCCACTTGCTGG + Intronic
954656698 3:52198319-52198341 GGCACCGCTGCCCCGGGTGCTGG + Intronic
954803739 3:53202897-53202919 GGAGCAGCGGCCACCGGTGGAGG + Intergenic
957560184 3:81812286-81812308 GGGCCGGCTGCTCCCAGTGCCGG + Intergenic
961182531 3:124887520-124887542 GGGCCAGCTCCGCCCTGTGCGGG + Intronic
961445336 3:126978002-126978024 GGAACAGATGCCCCCTGTGCCGG - Intergenic
962301923 3:134250736-134250758 TGGGCAGCCGCCCCCGGCTCGGG - Exonic
962396505 3:135019156-135019178 GGGGCAGCCACCTCCTGTGCTGG - Intronic
962515913 3:136151769-136151791 GGAGCAGATGCCCCCAGTGTTGG + Exonic
962827433 3:139110258-139110280 TTGGCACCTGCCCCCGGCGCAGG + Intronic
964495383 3:157283923-157283945 AGGGCAGCTGGCCCCTGTGTGGG + Intronic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968952665 4:3702813-3702835 AGGGGAGCAGCCCTCGGTGCTGG + Intergenic
969220266 4:5754496-5754518 GAGTCAGCTGGCCCCAGTGCAGG + Intronic
969250185 4:5962629-5962651 GGGGCACCTGGCTCCGGAGCTGG - Intronic
971564157 4:28117220-28117242 GGCGCAGGAGCCCACGGTGCTGG + Intergenic
971853133 4:32010193-32010215 GGGGCAGCCGCAGCCAGTGCTGG - Intergenic
972385240 4:38559646-38559668 GGGCCAGCCAACCCCGGTGCTGG + Intergenic
972960609 4:44448253-44448275 TGGGCAGCTCGCCCCGGCGCCGG + Exonic
973636074 4:52862760-52862782 GGGGCAGCGGCTCCCTGCGCGGG - Intronic
974069319 4:57110035-57110057 GGGGCAGCAGCCGGCGGTCCGGG - Exonic
975710695 4:77157648-77157670 GCGCCAGCTCCCCCCGGGGCTGG - Intronic
976272765 4:83247715-83247737 GGGTGAACTGCCCCCGCTGCTGG - Intergenic
978384694 4:108167927-108167949 GCGGCAGCTGCTCCGGCTGCCGG - Exonic
980027547 4:127783410-127783432 GGGACAGCTGCCCCCGACTCCGG - Intronic
985279447 4:188270811-188270833 GGGGCTGCTGCTGCTGGTGCTGG - Intergenic
985723056 5:1500888-1500910 GAGGCAGCTGGACCTGGTGCGGG - Intronic
985745698 5:1645569-1645591 GGGTCCGCTAGCCCCGGTGCTGG - Intergenic
986745126 5:10736987-10737009 GCAGCAGCTGACCCAGGTGCTGG - Intronic
991815725 5:70509177-70509199 GGGGCTGCTGCGGCAGGTGCAGG - Intergenic
997196917 5:131986344-131986366 AGGGCAGCTGCCCCCGGGATGGG - Intronic
998119164 5:139561757-139561779 GTGGCGGCGGCCCCCGGGGCGGG - Exonic
998158585 5:139800105-139800127 GGGGCAGCTGCCATCTGAGCTGG - Intronic
999249937 5:150176525-150176547 GGGGCAGGTGCTCCCTGTGGGGG + Intronic
1001328429 5:170745789-170745811 GGGGCAGCTGCCCCGAGGGAAGG - Intergenic
1002059872 5:176620002-176620024 GGGGAGGGTGCCCCCGGGGCTGG - Intergenic
1002169626 5:177367764-177367786 GGGGCAGCTGCCACCCGTTGAGG + Exonic
1002660481 5:180788163-180788185 GTGGCGGCTGCCCCCGGGCCCGG - Intergenic
1003270878 6:4606822-4606844 GGGGCAGCTGCCCACAATCCCGG - Intergenic
1003307988 6:4946374-4946396 GGTGCATCTGCCCCCAGTGGGGG + Intronic
1003600328 6:7511039-7511061 GCAGCAGCTGCCCCAGGTCCTGG + Intergenic
1004499688 6:16198368-16198390 GGGCCGGCTGCTCCCAGTGCGGG + Intergenic
1006299301 6:33185330-33185352 GGGGAAGCTGCCCTCCGAGCTGG + Intronic
1006683273 6:35812412-35812434 GGGGCAGCTGTGCCTGGGGCTGG + Intronic
1006820054 6:36885978-36886000 GCGGCAGCTGTCCCCGAGGCGGG + Exonic
1010141879 6:72622131-72622153 GAGGCCGCTGCCCCCGCCGCAGG + Exonic
1012475815 6:99613895-99613917 TGCGCAGCTGCCCCCTGCGCCGG + Exonic
1013220677 6:108074702-108074724 GCGGCGGCTGTCCGCGGTGCCGG - Exonic
1014550990 6:122789542-122789564 GGGGCAGCTGCCCCCGGCAGAGG + Intronic
1014551122 6:122790156-122790178 GCGGCTGCTGCCACCGGTCCAGG - Intronic
1017056545 6:150441784-150441806 GGGGCATCAACCCCCTGTGCAGG - Intergenic
1018219471 6:161564138-161564160 GGGGCAACTGCTCCAGGAGCTGG - Intronic
1018677744 6:166237166-166237188 GGGCCGGCTGCCCTGGGTGCTGG - Intergenic
1018787022 6:167116411-167116433 GGCCCAGCTGCCTCCTGTGCTGG - Intergenic
1019179310 6:170176790-170176812 GGGGCAGCTGGCTCCGGAGGCGG + Intergenic
1019190489 6:170247976-170247998 GGGGCATCTGGCCCCAATGCCGG + Intergenic
1019353723 7:568282-568304 GGGGCAGCTTCCCCAGGAGCAGG - Intronic
1019408994 7:898520-898542 CCGGCAGCTGCCCACCGTGCTGG + Exonic
1019449974 7:1092463-1092485 GGGGCCGCAGCCCACGGTGCCGG - Exonic
1019482907 7:1274598-1274620 GGGGACGCTGCCCGCAGTGCAGG - Intergenic
1019536057 7:1530578-1530600 GGGCCAGCGGCCCCCCGGGCGGG + Intergenic
1020114789 7:5470387-5470409 CGGGCAGCTGCCCCAGCTCCTGG + Intronic
1023295922 7:38715125-38715147 GGGGCAGCTGCAGCTGGTGAGGG + Intergenic
1023860898 7:44217283-44217305 GGGTCGGCTGCCCACGGTGCTGG - Exonic
1024013781 7:45293272-45293294 GGGGAAGCTGGCCCCAGTGGAGG + Intergenic
1027459407 7:78434469-78434491 TGGGCAGCTCCCCCTGGTGAGGG + Intronic
1028128909 7:87147292-87147314 TGGGCAGCTGCCCCACGTGATGG - Intergenic
1031895989 7:127348050-127348072 GGGACCGCTGCCACCCGTGCGGG - Intronic
1033376195 7:140763489-140763511 GGGGCGGCTGGCCCAGGAGCTGG + Intronic
1034165253 7:149020551-149020573 CAGGCAGCTGCCCCAAGTGCAGG - Intronic
1034270660 7:149802145-149802167 GGGGCAGCTGCCCGCGTGACCGG + Intergenic
1035172034 7:157022152-157022174 GGGGCAGCCTCCCCCGGTCAGGG + Intergenic
1035255113 7:157621072-157621094 TGGCCACCTGCCCCCGGGGCTGG + Intronic
1035333406 7:158111029-158111051 GGGGCAGCTGACCCCAGGCCAGG - Intronic
1037568745 8:20140925-20140947 GGGGCAGCCGACCATGGTGCAGG - Intergenic
1037835889 8:22214515-22214537 GGGGCAGCTGCACTGGGTGGGGG - Intergenic
1037917013 8:22778883-22778905 GGGGCTGCTGCCACCAGGGCGGG + Intronic
1039921418 8:41896666-41896688 GGGGCGGCTGCCCGCGGCCCGGG + Exonic
1041839196 8:62249066-62249088 GGTGCAGCAGCCCATGGTGCCGG - Exonic
1042196719 8:66237511-66237533 GGGGCAGGTGCACCAGGTGCTGG + Intergenic
1042224585 8:66505404-66505426 GGGGCAGCAGCTCCAGGGGCTGG - Exonic
1045347255 8:101304435-101304457 GGGGCAGGTGACCCCTGTGCTGG - Intergenic
1046644169 8:116766732-116766754 GGGGCAGCTGCTCCCGCAGCTGG - Exonic
1047615350 8:126558271-126558293 GGGGCAGCAGCCCCAGCTGGCGG - Exonic
1048050153 8:130808854-130808876 AGGGCAGCTGTCCCAGGTGCTGG - Intronic
1048984889 8:139730075-139730097 GGGCCAGCTGCCCACTGTGGCGG + Intergenic
1049424196 8:142530807-142530829 GAGGCAGGTGCCCGGGGTGCGGG - Intronic
1049748573 8:144273197-144273219 CCGGCAGCTGCCTCCAGTGCTGG - Intronic
1049788396 8:144462224-144462246 GGGGCTGCAGCCCCCGCCGCGGG - Intronic
1050182228 9:2934003-2934025 GGTGCAGCTGCAGCCGCTGCAGG + Intergenic
1052087904 9:24290801-24290823 GGGGAAGCTGCCCAAGGTGATGG - Intergenic
1053129226 9:35605676-35605698 GGGGGAGGGGCCCCCGGGGCCGG + Exonic
1055051898 9:71989722-71989744 GTGACAACTGCCCCAGGTGCAGG - Intergenic
1056129638 9:83571287-83571309 TGGGCAGCTGCCTCTGGTGAAGG - Intergenic
1056805076 9:89722120-89722142 TGGGCAGCTGCCCTGGCTGCCGG + Intergenic
1059340409 9:113594692-113594714 AGGGCAGCTGCTCCCTGTGAGGG - Intronic
1059909656 9:119028080-119028102 GAGGCAGATGCCCCTGGTGGAGG - Intergenic
1061009776 9:127948126-127948148 GGTGCTGCTGCCCCCACTGCTGG + Exonic
1061672799 9:132198514-132198536 GCGGCTGCTGCGCCCGGCGCTGG + Exonic
1061790857 9:133058111-133058133 GGGTCAGCTGCACCCTTTGCTGG - Exonic
1061972596 9:134053055-134053077 AGGGCGGCTGCCCCAGGTGCAGG - Intronic
1062581375 9:137230631-137230653 GGGGCACCGGCCCTCGGTACTGG - Intergenic
1062656633 9:137607040-137607062 GGGCCAGCTGCCCAAAGTGCTGG - Intronic
1203744898 Un_GL000218v1:36203-36225 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1203565207 Un_KI270744v1:83281-83303 GGCCCAGCAGCCCCAGGTGCTGG - Intergenic
1186434595 X:9532197-9532219 GGGGCAGGGGCTCCCAGTGCAGG - Intronic
1186486466 X:9937629-9937651 GGAGCAGCTTCCTCCGTTGCTGG - Exonic
1192180348 X:68912223-68912245 GGGGCGGCTGCCGCCGGGCCTGG + Intergenic
1198750339 X:139932272-139932294 GGGGCCGCCGCCCCCGGGTCAGG - Intronic
1199302090 X:146224513-146224535 GGGGAAGGTGCCCACGCTGCAGG + Intergenic
1201158234 Y:11151246-11151268 GGCCCAGCAGCCCCAGGTGCTGG + Intergenic
1201901126 Y:19046841-19046863 GGGCCAGCCGCTCCCAGTGCGGG + Intergenic