ID: 1175424070

View in Genome Browser
Species Human (GRCh38)
Location 20:58853369-58853391
Sequence GGGCAGCTGCCCCCGGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 258}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424055_1175424070 23 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424059_1175424070 4 Left 1175424059 20:58853342-58853364 CCGAGCAACCACCTTTGGAGGCC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424053_1175424070 25 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424064_1175424070 -7 Left 1175424064 20:58853353-58853375 CCTTTGGAGGCCCCAGGGGCAGC 0: 1
1: 0
2: 2
3: 29
4: 298
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424058_1175424070 5 Left 1175424058 20:58853341-58853363 CCCGAGCAACCACCTTTGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424063_1175424070 -4 Left 1175424063 20:58853350-58853372 CCACCTTTGGAGGCCCCAGGGGC 0: 1
1: 0
2: 8
3: 46
4: 333
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424052_1175424070 26 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424054_1175424070 24 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424051_1175424070 27 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424070 Original CRISPR GGGCAGCTGCCCCCGGTGCT GGG Exonic