ID: 1175424070

View in Genome Browser
Species Human (GRCh38)
Location 20:58853369-58853391
Sequence GGGCAGCTGCCCCCGGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 258}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175424051_1175424070 27 Left 1175424051 20:58853319-58853341 CCCCCCTGAAATCGGGGAACAGC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424055_1175424070 23 Left 1175424055 20:58853323-58853345 CCTGAAATCGGGGAACAGCCCGA 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424058_1175424070 5 Left 1175424058 20:58853341-58853363 CCCGAGCAACCACCTTTGGAGGC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424063_1175424070 -4 Left 1175424063 20:58853350-58853372 CCACCTTTGGAGGCCCCAGGGGC 0: 1
1: 0
2: 8
3: 46
4: 333
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424059_1175424070 4 Left 1175424059 20:58853342-58853364 CCGAGCAACCACCTTTGGAGGCC 0: 1
1: 0
2: 1
3: 18
4: 156
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424053_1175424070 25 Left 1175424053 20:58853321-58853343 CCCCTGAAATCGGGGAACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424064_1175424070 -7 Left 1175424064 20:58853353-58853375 CCTTTGGAGGCCCCAGGGGCAGC 0: 1
1: 0
2: 2
3: 29
4: 298
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424052_1175424070 26 Left 1175424052 20:58853320-58853342 CCCCCTGAAATCGGGGAACAGCC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258
1175424054_1175424070 24 Left 1175424054 20:58853322-58853344 CCCTGAAATCGGGGAACAGCCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG 0: 1
1: 0
2: 1
3: 28
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175424070 Original CRISPR GGGCAGCTGCCCCCGGTGCT GGG Exonic
900124871 1:1064828-1064850 GGGCAGCTGCCCTCGGTGGGAGG + Intergenic
900158744 1:1213611-1213633 AGGCTGCCGCCCCCTGTGCTGGG + Intronic
900321725 1:2087855-2087877 TGGATGCTGCCCCCGGTGCCCGG - Intronic
900368845 1:2322634-2322656 GGGAGGCTGTCCCCGGTGCCCGG - Intronic
900371873 1:2335836-2335858 GGGCAGCTGCGCGCTGGGCTGGG - Intronic
900430351 1:2598451-2598473 GCCCATCTGCCCCGGGTGCTTGG + Intronic
900548398 1:3241430-3241452 GGGCAGCTGCCACAGCTGCTGGG - Intronic
900700872 1:4047942-4047964 GGGCAGCTCCCTCTGTTGCTGGG + Intergenic
900884210 1:5403935-5403957 GGGCTGCTGCTGCTGGTGCTGGG - Intergenic
900947762 1:5840959-5840981 GGGCAGTTGCCCCGGGGACTGGG - Intergenic
901632328 1:10653925-10653947 GGGCTGCCGCCCTCGCTGCTGGG - Exonic
902878109 1:19353092-19353114 GGGCAGCTGCCGCTGCTGCCGGG + Intronic
902925014 1:19690288-19690310 GGGCAGCTGCCCCACGTGATGGG + Intronic
902943076 1:19814482-19814504 CAGCAGCTGCCCCGGGTGCTGGG + Exonic
903651939 1:24927814-24927836 GGGCAGCTCCCCCAGGTCCCAGG + Intronic
903931564 1:26865157-26865179 GGGCAGCTCCCTCCTGTGATTGG - Intergenic
904114303 1:28150260-28150282 GGGCAGCTGCACCACGTGGTGGG + Exonic
904756664 1:32771879-32771901 GGGCCGATGGCCCCAGTGCTGGG - Exonic
905203346 1:36328424-36328446 CAGCAGCTGTCCCAGGTGCTGGG - Exonic
906802200 1:48748193-48748215 GGGAAGATGCCTCCGGAGCTGGG + Intronic
913030017 1:114892456-114892478 GGGCATGTGACCCCGCTGCTGGG + Intronic
917969189 1:180196425-180196447 GGGCAGCTGACCCAGCTGCAGGG - Exonic
918058989 1:181045915-181045937 GGCCGGCTGCCCCCAGTGCAGGG - Intronic
921939425 1:220824666-220824688 GGGCAGCTTCCCATGATGCTGGG + Intergenic
922749598 1:228064353-228064375 GGGCTGCTGCACCTGGTGCATGG + Intergenic
922802319 1:228370136-228370158 GGTCAGCTGCCCCCGGGGCAGGG - Intronic
922903456 1:229156207-229156229 AGGCAGCTGACCCAGGAGCTCGG - Intergenic
924404693 1:243730592-243730614 GGGCAGCTGCCCCATGTGACAGG + Intronic
924722825 1:246639050-246639072 CAGCAGCTGCCACCAGTGCTTGG + Intronic
1063117795 10:3084624-3084646 GGGCAGCTGCCACCAGGGCCAGG - Intronic
1063557843 10:7097443-7097465 GGGCATCTTCCACCCGTGCTGGG - Intergenic
1067428093 10:46224361-46224383 GGGGAGATGCCCCAGGTACTGGG - Intergenic
1067478327 10:46580163-46580185 GAGCAGCTGGCCCTGGTGATTGG + Exonic
1067616411 10:47761624-47761646 GAGCAGCTGGCCCTGGTGATTGG - Intergenic
1067726813 10:48776786-48776808 GGCCAGCTGCCCCAGATGCTGGG + Exonic
1068791031 10:61031509-61031531 GGGCAGCTGTCCACAATGCTTGG - Intergenic
1073512490 10:104051566-104051588 GGACATCTGGCCCCGGTGCAGGG + Intronic
1074814063 10:117131626-117131648 GGGCCGCTGCCCCCGCAGCGCGG + Intronic
1076063855 10:127433306-127433328 AGGCAGCCGCCCCCGGTCCATGG + Exonic
1076096899 10:127739437-127739459 GGGAAGCTGCCGCAGGGGCTGGG + Exonic
1076882875 10:133248083-133248105 GGGCTGCTGGCCCGGGAGCTGGG + Intergenic
1077486093 11:2839038-2839060 GGGCAGCTGCCTCGGGCTCTTGG + Intronic
1077730333 11:4723151-4723173 GGCCAGCTCCCCACGCTGCTCGG + Intronic
1078513895 11:12007414-12007436 GGGGAGCTGTCCCTGGTGCCTGG - Intronic
1079101418 11:17544397-17544419 GGCCAGCCGCCCTCGGAGCTGGG + Intronic
1081775063 11:45671009-45671031 GGGCACCTGCCCACAGTGTTTGG - Intergenic
1084118273 11:67054451-67054473 GGGCAGTAGGCCACGGTGCTGGG + Intergenic
1084204411 11:67583678-67583700 GTGCAGCGGCCGCCGGGGCTGGG + Exonic
1084216406 11:67649027-67649049 TGACAGCTGCCCCCAGGGCTGGG - Intronic
1089177410 11:116558567-116558589 GGGCAGGTGCCCCAGCTGCCGGG + Intergenic
1089599230 11:119603271-119603293 GGCCAGCTCCCCACGCTGCTGGG + Intergenic
1089631663 11:119788125-119788147 AGGCAGCTTCCCCTGGGGCTGGG - Intergenic
1090780363 11:130002147-130002169 GGCCCCCAGCCCCCGGTGCTCGG + Intronic
1092206014 12:6614433-6614455 GGGCAGGTTTCCACGGTGCTAGG - Intergenic
1095307071 12:40651249-40651271 GGGCAGCTGCCTCCAGTGGCAGG - Intergenic
1096154320 12:49333320-49333342 GGGCAGCCGCCGCAGGGGCTGGG + Intronic
1096569963 12:52516804-52516826 GGCCAGCTCCCCACGCTGCTCGG + Exonic
1098290209 12:68950935-68950957 TGGCTTCTGCACCCGGTGCTTGG - Intronic
1101772097 12:107761052-107761074 GGGCAGCGGCCCCCGGGGTGAGG - Exonic
1102149279 12:110677617-110677639 GGGCAGCTGAGCCTGCTGCTTGG - Intronic
1103284169 12:119786430-119786452 GGACAGCTGCCCTCAGTGGTTGG + Intronic
1103348177 12:120265175-120265197 GGGCAGCTGCTCCCCGAGTTGGG + Intronic
1103386330 12:120534997-120535019 GGGCGACTGCCCCTGCTGCTGGG + Intronic
1104785457 12:131445395-131445417 GGCCAGCTGCCCTGGGTGCTGGG - Intergenic
1104796777 12:131525861-131525883 GGACAGCGGCCGCCGCTGCTGGG - Intergenic
1104973394 12:132541437-132541459 GGGCAGCTGTCCCCGGGGTGGGG - Intronic
1105787360 13:23762687-23762709 GGGCAGCCGCCTCCTGTGCTGGG + Intronic
1108267866 13:48730444-48730466 GAGCACCTGCCCTGGGTGCTGGG - Intergenic
1109370292 13:61413820-61413842 GGGCAGCAGCCGCAGGTCCTCGG + Exonic
1110887205 13:80654963-80654985 GTGCTGCTGCCCCCGCTGCGGGG + Intergenic
1112390508 13:98979467-98979489 GAGCAGCTGCAGCAGGTGCTAGG - Intronic
1113576827 13:111400900-111400922 TGGCAGCTGCATCCTGTGCTTGG + Intergenic
1118363900 14:65077882-65077904 GGCCAGCTGCCCCACGAGCTCGG + Intronic
1118603074 14:67483796-67483818 GGGCAGCTGGCCCCTGCTCTTGG - Intronic
1118942191 14:70348163-70348185 CAGCAGCTGCCTCCAGTGCTTGG - Intronic
1119692784 14:76690302-76690324 GGGCAGCTGCCCAGGGTGCTGGG - Intergenic
1120924003 14:89780114-89780136 GGCCAGCTGTCCCCAGTGCCTGG + Intergenic
1121569518 14:94936870-94936892 GGCCCGCTGCCCCCGGTGCGCGG - Intergenic
1122387698 14:101360401-101360423 GGGCGGCTCCCCGGGGTGCTCGG - Intergenic
1122855708 14:104559230-104559252 GGCCAGCATCCCCGGGTGCTGGG - Intronic
1122902972 14:104789361-104789383 GGGCAGCTCTCCACGGGGCTAGG + Intronic
1124238878 15:28013746-28013768 GGGCAGCTGTCCTCTGGGCTGGG - Intronic
1124963388 15:34414870-34414892 GGGCAGCTGCCTCTGCTGCCTGG + Intronic
1124980009 15:34561096-34561118 GGGCAGCTGCCTCTGCTGCCTGG + Intronic
1126137083 15:45402785-45402807 GGGCAGGCGCGCCCGGTGCCCGG + Exonic
1129120752 15:73394971-73394993 GAGCAGCTGGCCCCAGTTCTGGG - Intergenic
1131116543 15:89799629-89799651 GAGCAGCTGCCCCCGCAGCCTGG + Intronic
1132674884 16:1117436-1117458 GGACAGCTGCCCCCTGTGCCTGG + Intergenic
1134015185 16:10883219-10883241 GGGAACCTGACCCTGGTGCTGGG - Intronic
1135517522 16:23148581-23148603 GGGCAGGTGCCCCAGGGGCTCGG + Intronic
1136417185 16:30111444-30111466 GGGCAGCAGCCCCAGGTAGTAGG + Exonic
1136776075 16:32872611-32872633 GGACAGCTGGCCTCAGTGCTTGG + Intergenic
1136894540 16:33988901-33988923 GGACAGCTGGCCTCAGTGCTTGG - Intergenic
1137251289 16:46742865-46742887 GTCCTGCTGCCCCCGGAGCTGGG + Intronic
1137958058 16:52852933-52852955 AGGCTGCTGCCACCAGTGCTGGG - Intergenic
1138453999 16:57110769-57110791 TGGGGGCTGCCCCCGCTGCTGGG - Exonic
1138598115 16:58040212-58040234 GGGCAGGTGGCCCCGGAGCTGGG + Intronic
1138979576 16:62250661-62250683 GGGCAGCTCCCCCAGCAGCTGGG + Intergenic
1139821019 16:69721362-69721384 GGGCAGGTGAGCCCCGTGCTGGG - Intronic
1140468102 16:75198159-75198181 GGGCAGCTGCATCCAGTGATTGG - Intergenic
1140482934 16:75272315-75272337 GGGCAGCTGCCGGGGGTGCCTGG - Intergenic
1141530470 16:84643122-84643144 GGGCGTCTGGCCCCAGTGCTTGG - Intergenic
1141603021 16:85137614-85137636 GGGCAGCTTCGCCCGGGACTGGG - Intergenic
1142127845 16:88419113-88419135 GGGCAGCAGCCTCCGGTCCCAGG - Intergenic
1142299449 16:89247821-89247843 GGGCAGCTGCCCGCCCTCCTCGG + Intergenic
1203078491 16_KI270728v1_random:1134720-1134742 GGACAGCTGGCCTCAGTGCTTGG + Intergenic
1142804224 17:2363122-2363144 GGGCACCTACCCCCAGGGCTGGG - Exonic
1143147915 17:4788837-4788859 GGGCAGCTACCCTGGGTGCGAGG - Intergenic
1143165274 17:4894360-4894382 GGGCAGGAGGTCCCGGTGCTGGG + Intronic
1143183376 17:4997488-4997510 GCGCAGCTGCTTCAGGTGCTGGG - Intronic
1146894916 17:36534406-36534428 GGGCAGCTGCGCCCTTGGCTGGG - Intronic
1147554015 17:41464821-41464843 GGGCAGCTGCCTCCCAGGCTTGG + Intronic
1148218948 17:45849161-45849183 GGGCAGCTGCACCCTCTGCCAGG + Intergenic
1148562625 17:48614559-48614581 TGGAAGCTGCCGCCGCTGCTGGG + Exonic
1150108604 17:62479129-62479151 GGGCAGCCGCCGCCGGCGCCGGG - Exonic
1150237028 17:63601382-63601404 GGGCAGCGGCAGCCAGTGCTGGG - Intronic
1150382161 17:64729353-64729375 TGGCAGCTGCCCCGGTGGCTCGG - Intergenic
1150774105 17:68065498-68065520 TGGCAGCTGCCCCGGTGGCTCGG + Intergenic
1151671719 17:75574688-75574710 GTGCAGCTGCCAACCGTGCTGGG + Intronic
1152896698 17:82915444-82915466 GAGCTGCTTCCCCCGGTGCCAGG + Intronic
1153136261 18:1920772-1920794 TGGCAGGGGCCCACGGTGCTAGG + Intergenic
1155047515 18:22115782-22115804 GGGGAGCTGCTCCTGGTTCTGGG + Intergenic
1155519915 18:26657143-26657165 GGGCTGCCGCTCCCGGTTCTCGG - Intronic
1156491148 18:37496977-37496999 AGGCAGCTGGCCCCGGTCCTGGG + Intronic
1157176594 18:45457853-45457875 GAGCAGCTACCCCCGGGGCTGGG + Intronic
1157596161 18:48865119-48865141 AGCCAGCTGCCCCCGGGACTCGG + Intergenic
1160370509 18:78368904-78368926 GGGCAGCTGTGGCCGGTGCCGGG - Intergenic
1160830522 19:1102767-1102789 GGGCAGCTGCCCCTGGGGGTGGG + Intergenic
1160860242 19:1234538-1234560 GGGCAGCAGCCCCGGTTCCTCGG - Intronic
1160894479 19:1396199-1396221 CGCCAGATGCCGCCGGTGCTGGG + Intergenic
1160939663 19:1614384-1614406 GCCCAGCCGCTCCCGGTGCTCGG + Intronic
1160983569 19:1827510-1827532 GGCCAGCAGCCCCCGGCGCAAGG - Exonic
1163415053 19:17181247-17181269 GGGAAGCTGCCCCGTGTGCTGGG - Intronic
1163569479 19:18072212-18072234 GGGCATCTTCCCCAGGTGCAGGG + Exonic
1165065246 19:33224889-33224911 GGCCAGCTGCTCCCTGAGCTGGG - Intronic
1165901782 19:39172681-39172703 AGGCTGCTGCCCCCTGGGCTCGG - Intronic
1167456012 19:49596997-49597019 GAGCCGCTGCCCCCGGCGCCTGG + Exonic
1168234766 19:55055587-55055609 GGTCAGCTTCCCACAGTGCTGGG - Intronic
1168335111 19:55593011-55593033 GGGGAGCAGCCCCCCGAGCTTGG + Exonic
925663874 2:6232216-6232238 GGGCAGCTGCCCAAACTGCTAGG - Intergenic
925770902 2:7282272-7282294 GGTCAGCTGCCCACTGTGCTGGG + Intergenic
925903117 2:8522751-8522773 GGGGAGCAGACCCAGGTGCTGGG - Intergenic
927518468 2:23685692-23685714 GGTCTCCTGCCCCCGGTGCTTGG + Intronic
928170890 2:29002445-29002467 GGGCAGAAGGCCCCGTTGCTGGG + Intronic
930071474 2:47369628-47369650 GGGCAGCGGCCCCCGGCCCTCGG + Intronic
930143919 2:47981757-47981779 CAGCAGCTGCCCCTGGTGCATGG + Intergenic
930737465 2:54794168-54794190 AGGCAGCTGGCCCTGCTGCTTGG + Intronic
931194014 2:60033311-60033333 GTACTGTTGCCCCCGGTGCTTGG - Intergenic
931955420 2:67418793-67418815 GGGCAGCTGTGCCCTGTGCAGGG + Intergenic
932104752 2:68932331-68932353 GGGCAGCTGCCTCCTGTGGCTGG - Intergenic
933063663 2:77768631-77768653 GAGCAGCTGCCCTCTCTGCTAGG + Intergenic
934664128 2:96158233-96158255 TGGGGGCTGCCCCCTGTGCTGGG - Intergenic
942461538 2:176171825-176171847 GGCCAGCTGCCGCCAGTGCCCGG + Exonic
944397153 2:199281106-199281128 GGGCAGGTTCCCCCGATACTTGG + Intronic
944831049 2:203534776-203534798 GGCCACCAGCCCCCGGTGCTGGG + Intronic
946320881 2:218953807-218953829 GGCCAGCTCCCCCCACTGCTCGG + Intergenic
1168958980 20:1855347-1855369 GGGCAGCTGCCTCCGTGGCCTGG + Intergenic
1169001177 20:2169031-2169053 GGGCAGCTGACCTTGGGGCTCGG + Intronic
1171013859 20:21522784-21522806 GGGGAGCTGCCCCCTCCGCTGGG - Intergenic
1171255234 20:23685356-23685378 AGGCAGCTGCCCCAGAAGCTGGG - Intergenic
1171262571 20:23747278-23747300 AGGCAGCTGCCCCAGAAGCTAGG - Intergenic
1171279295 20:23882523-23882545 GGACAGCTGCTCCAGCTGCTGGG + Intergenic
1172207492 20:33174260-33174282 GGGCACCTCCTCCCGCTGCTGGG + Intronic
1173494258 20:43507609-43507631 GGGCAGATGTGCCCGGCGCTCGG + Intergenic
1173836403 20:46128833-46128855 GCACAGCTGCCCCTGCTGCTGGG + Intronic
1174036692 20:47672858-47672880 GGGCTGCTGCCCCAGGGACTTGG + Intronic
1175424070 20:58853369-58853391 GGGCAGCTGCCCCCGGTGCTGGG + Exonic
1175804138 20:61817979-61818001 GGGCAGCTGCCCCAGGTGTGAGG - Intronic
1178407126 21:32334169-32334191 GGGCAGCAGCCTCCGGTTCTGGG + Exonic
1178892135 21:36528960-36528982 GGGCAGGTGACCCCCTTGCTTGG - Intronic
1179667184 21:42921041-42921063 CAGCAGCTGCCACCAGTGCTTGG + Intergenic
1179725991 21:43341529-43341551 TGGCAGCTGCCCGGGGAGCTGGG - Intergenic
1179878967 21:44285672-44285694 GGGCAGCTGCCTTGGGGGCTGGG - Intergenic
1179975186 21:44861445-44861467 GGGCTGCTGGCCGCTGTGCTGGG - Intronic
1179984741 21:44914065-44914087 GGGCACCTGCCCCCAGTGTGGGG - Intronic
1180701584 22:17784260-17784282 GGGCAGGTGGTCCCTGTGCTGGG + Intergenic
1180871308 22:19148805-19148827 GGGGACGGGCCCCCGGTGCTTGG - Exonic
1182295975 22:29311458-29311480 GGGCAGCTGATCCCGGGGCCTGG - Intronic
1183192226 22:36329079-36329101 GGGCAGCTGCCATTGGTGTTGGG - Intronic
1183248189 22:36710021-36710043 GGGCTGTTGGCCCCGGGGCTGGG + Intergenic
1183582572 22:38734680-38734702 GAGCAGCTGCCCTAGGTGATAGG + Intronic
1183604738 22:38861683-38861705 GGGGACCTGCCCCCCATGCTGGG + Exonic
1184343366 22:43898272-43898294 GGGCAGCTTCCCACGGCCCTGGG + Intergenic
1184523443 22:45008664-45008686 GTGCCGCGGCCCGCGGTGCTGGG - Intronic
1185136647 22:49077267-49077289 TGCCAGCTGTCCACGGTGCTGGG + Intergenic
950589914 3:13929706-13929728 GGCCAGCTGCCCCTGCTGCTGGG + Intergenic
950709500 3:14804485-14804507 GGCCAGCCGCCCCTGCTGCTGGG + Intergenic
954442096 3:50527489-50527511 GGGGAGCTGCCTCTGGTGCCAGG + Intergenic
954656699 3:52198320-52198342 GCACCGCTGCCCCGGGTGCTGGG + Intronic
962301922 3:134250735-134250757 GGGCAGCCGCCCCCGGCTCGGGG - Exonic
962515914 3:136151770-136151792 GAGCAGATGCCCCCAGTGTTGGG + Exonic
962712819 3:138101898-138101920 GGCCAGCTCCCCACGTTGCTCGG + Intronic
965493315 3:169366617-169366639 GGGCAGCTGGCCTCTGTGCCAGG + Intronic
965605774 3:170496444-170496466 GGCCAGCTCCCCACGCTGCTCGG - Intronic
966878357 3:184336159-184336181 GGGCTGCGGCCGCCGGTGCGCGG + Intronic
968917665 4:3503928-3503950 GGGCAGCAGCACTGGGTGCTTGG - Intergenic
969239258 4:5888417-5888439 GCGCGGCTGCCCCGGCTGCTCGG + Intronic
969595096 4:8144195-8144217 GGGAAGCAGCCCCTGGTGCTCGG + Intronic
970689502 4:18606372-18606394 CTGCAGCTGCCCCAGGTGCGTGG + Intergenic
970794070 4:19891247-19891269 CAGCAGCTGCCGCCAGTGCTTGG - Intergenic
971564158 4:28117221-28117243 GCGCAGGAGCCCACGGTGCTGGG + Intergenic
971593508 4:28498170-28498192 GGGCAGCTGGACCCTGGGCTTGG + Intergenic
972385241 4:38559647-38559669 GGCCAGCCAACCCCGGTGCTGGG + Intergenic
972960610 4:44448254-44448276 GGGCAGCTCGCCCCGGCGCCGGG + Exonic
975710694 4:77157647-77157669 CGCCAGCTCCCCCCGGGGCTGGG - Intronic
979790951 4:124780662-124780684 GGGCAGAAGCACCAGGTGCTTGG - Intergenic
979881111 4:125961621-125961643 AGGCAGCTGCCCCAAGTGATGGG + Intergenic
983077692 4:163344573-163344595 GCGCAGCTGCCTCCCGGGCTCGG - Exonic
983209037 4:164939930-164939952 GGCCAGCTGCCCCATGTGCCTGG - Intergenic
985605728 5:857232-857254 GCGCTGCAGGCCCCGGTGCTGGG - Intronic
985667318 5:1187825-1187847 GGGCGGCTGCGGCCGGTCCTCGG + Intergenic
985775346 5:1838224-1838246 GGGCAGGTCCCCTCGCTGCTGGG + Intergenic
986568874 5:9144740-9144762 GGACAGATGCTCCCGCTGCTTGG + Intronic
990665681 5:58069214-58069236 GGGCAGCAGCCCCCAGCGGTGGG + Intergenic
992961083 5:81957136-81957158 GGGCAGCAGCAGCCGCTGCTCGG - Intergenic
997206518 5:132053541-132053563 GGGAAGCTGCCACCTGGGCTGGG - Intergenic
997853220 5:137351285-137351307 GTGCAGCTGCCCAAAGTGCTTGG + Intronic
999214124 5:149917522-149917544 GTGCAGCTGCCGCCAATGCTAGG - Intronic
999431889 5:151531714-151531736 GGGCACCTGCACGCTGTGCTCGG + Exonic
1000610146 5:163365117-163365139 GGGCAGCTGCCCCACATGATGGG + Intergenic
1001797985 5:174518232-174518254 GGGCAGAGGCACCCGGTGATTGG - Intergenic
1002059871 5:176620001-176620023 GGGAGGGTGCCCCCGGGGCTGGG - Intergenic
1002318788 5:178362790-178362812 GGGCAGCCTCTCCCAGTGCTTGG - Intronic
1002712145 5:181201842-181201864 GTGAAGCTGCCGCCGGTGCCAGG + Intronic
1003106785 6:3222732-3222754 TGGCAGCTGCCCCAGGTGTTTGG + Intergenic
1003266002 6:4565506-4565528 GGGCATCTGACCTCAGTGCTTGG - Intergenic
1003852844 6:10242546-10242568 GGGCAGGTGGTCCCGGTGTTGGG - Intergenic
1005994305 6:30922210-30922232 GGGCAGCTGCCCTGTGAGCTGGG - Exonic
1006299300 6:33185320-33185342 GGGCAGCTTCCCCCACTGCCTGG - Intronic
1006299302 6:33185331-33185353 GGGAAGCTGCCCTCCGAGCTGGG + Intronic
1006521532 6:34573809-34573831 GGGCAGCTCCCCACTGTGCCTGG - Intergenic
1007399947 6:41597901-41597923 GGGCTGCTGCTGCCGTTGCTGGG - Exonic
1007584194 6:42978840-42978862 GTGCGGCGGCCCCCGGCGCTAGG - Exonic
1007760094 6:44128233-44128255 CGGCCGCTGCCCCCGGCTCTGGG + Intronic
1010116382 6:72316862-72316884 GGGCAGCTGCCCCCAGGGGGAGG + Intronic
1012475816 6:99613896-99613918 GCGCAGCTGCCCCCTGCGCCGGG + Exonic
1017340349 6:153314315-153314337 GGGCATCTGCCCACAATGCTAGG + Intergenic
1017722839 6:157256127-157256149 GGGCAGCTGGGCCCTCTGCTTGG + Intergenic
1018202364 6:161407343-161407365 GGGCAGCTGCACTCGGTGGGAGG + Intronic
1018252220 6:161882425-161882447 GGGAAGCTGCCGCCTGGGCTGGG - Intronic
1018746781 6:166768478-166768500 AGGCAGCTGCCCCTGCCGCTTGG - Intronic
1019166857 6:170102941-170102963 CCGCGGCTGCCCCCGGGGCTGGG - Intergenic
1019571630 7:1715522-1715544 GGGCAGGAGACCCAGGTGCTGGG - Intronic
1025093681 7:56082076-56082098 GGGCCGGTGCCCCTGGCGCTGGG - Intronic
1028128908 7:87147291-87147313 GGGCAGCTGCCCCACGTGATGGG - Intergenic
1031971397 7:128067534-128067556 GGGCAGTGGCGCCCTGTGCTGGG + Intronic
1035045431 7:155962500-155962522 GGGCTGCTGTTCCCCGTGCTGGG + Intergenic
1037260355 8:17001501-17001523 GGGCAGCAGCTCCAGATGCTGGG - Intronic
1037260453 8:17001920-17001942 GGGGAGCGGCCGCCGCTGCTGGG - Exonic
1041113353 8:54508512-54508534 GCGAAGCTGCCCGCTGTGCTTGG + Intergenic
1041319984 8:56603062-56603084 GGGCAGCTGCCTAGAGTGCTTGG - Intergenic
1042196910 8:66238608-66238630 GGGCAGCTGCACCCAGGGATTGG + Intergenic
1044789563 8:95833885-95833907 CAGCAGCAGACCCCGGTGCTGGG + Intergenic
1044873453 8:96642329-96642351 CGGCAGCTGCCCCACCTGCTGGG + Intergenic
1045347254 8:101304434-101304456 GGGCAGGTGACCCCTGTGCTGGG - Intergenic
1045947688 8:107814902-107814924 TGGCAGCAGCCCCTGGTTCTCGG + Intergenic
1047965483 8:130043156-130043178 GGGAAGCTGCCCAAAGTGCTGGG + Intergenic
1049102461 8:140589389-140589411 GCGCAGCTGCCACCTGAGCTTGG + Intronic
1049728155 8:144160873-144160895 GGGAAGCAGCCCCCGGCGCCTGG - Intronic
1049774244 8:144397267-144397289 GGGCAGCTCCCCCTGGCGCGTGG + Exonic
1049791457 8:144474502-144474524 GGGCAGCTGCCCCCAGAGGGAGG + Exonic
1049847604 8:144810622-144810644 GGGCAGCTGCCCCAGGTGGAAGG - Intronic
1049896238 9:113901-113923 GCGCCGCCGCCCCCGGTGCCAGG - Intergenic
1052087903 9:24290800-24290822 GGGAAGCTGCCCAAGGTGATGGG - Intergenic
1053412588 9:37925266-37925288 GGGCAGCTTCTCCCTTTGCTGGG - Intronic
1053418690 9:37963160-37963182 GGGCAGTGGCCCCCGGGGATAGG + Intronic
1057292252 9:93814202-93814224 TGGCAGCTGCCCCAGTCGCTGGG - Intergenic
1057298279 9:93861782-93861804 GGGCAGATGCCACAGGTCCTGGG - Intergenic
1058826302 9:108778653-108778675 GAGCAGCTGCCCCCAGTCCCTGG + Intergenic
1060223062 9:121774493-121774515 GGACAGCAGCACCCGTTGCTGGG - Intronic
1061672800 9:132198515-132198537 CGGCTGCTGCGCCCGGCGCTGGG + Exonic
1061790856 9:133058110-133058132 GGTCAGCTGCACCCTTTGCTGGG - Exonic
1062277322 9:135737060-135737082 GGGCAGGGGCCCCCAGTGCCTGG - Intronic
1062392873 9:136340912-136340934 GCGCAGCTGCAGCTGGTGCTCGG + Exonic
1062451561 9:136617864-136617886 GGGCAGCAGCCGCCGGGGCCAGG - Intergenic
1062516508 9:136939678-136939700 GGGCAGCTGACCCGAGTGCCAGG + Intronic
1062581374 9:137230630-137230652 GGGCACCGGCCCTCGGTACTGGG - Intergenic
1062656632 9:137607039-137607061 GGCCAGCTGCCCAAAGTGCTGGG - Intronic
1062682172 9:137787925-137787947 GGGCAGCTGCCCCCAGAGGGAGG + Intronic
1186486465 X:9937628-9937650 GAGCAGCTTCCTCCGTTGCTGGG - Exonic
1189893786 X:45632704-45632726 GGCCAGCTCCCCACGCTGCTTGG + Intergenic
1192180349 X:68912224-68912246 GGGCGGCTGCCGCCGGGCCTGGG + Intergenic
1192315039 X:70044598-70044620 GGGCAGATGGGCCAGGTGCTGGG - Intronic
1194420612 X:93668840-93668862 GGCCAGCTGCCCCCGGCCCAAGG - Intergenic
1198093074 X:133351043-133351065 GGGCATGTGGCCCAGGTGCTAGG - Intronic
1198767225 X:140091825-140091847 GGGCAGCTGCTCCTCCTGCTCGG - Intergenic
1200103804 X:153701425-153701447 GGACAGCTGGCCTCAGTGCTTGG - Intronic
1201266345 Y:12210803-12210825 GGTCAGCTGCCCTCTGTGCATGG + Intergenic