ID: 1175428837

View in Genome Browser
Species Human (GRCh38)
Location 20:58889081-58889103
Sequence CAGCGGCCCCTATAAACCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175428837_1175428850 22 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428850 20:58889126-58889148 GGCTGGGGCGTCATCGGGGCCGG 0: 1
1: 0
2: 0
3: 21
4: 226
1175428837_1175428844 6 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428844 20:58889110-58889132 GTCGGTCCTCTGAAGAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 83
1175428837_1175428842 1 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428842 20:58889105-58889127 TATGGGTCGGTCCTCTGAAGAGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175428837_1175428848 17 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428848 20:58889121-58889143 GAAGAGGCTGGGGCGTCATCGGG 0: 1
1: 1
2: 0
3: 13
4: 157
1175428837_1175428849 18 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428849 20:58889122-58889144 AAGAGGCTGGGGCGTCATCGGGG 0: 1
1: 0
2: 2
3: 5
4: 91
1175428837_1175428847 16 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428847 20:58889120-58889142 TGAAGAGGCTGGGGCGTCATCGG 0: 1
1: 0
2: 0
3: 7
4: 186
1175428837_1175428845 7 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428845 20:58889111-58889133 TCGGTCCTCTGAAGAGGCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 139
1175428837_1175428843 5 Left 1175428837 20:58889081-58889103 CCTTCGGTTTATAGGGGCCGCTG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1175428843 20:58889109-58889131 GGTCGGTCCTCTGAAGAGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175428837 Original CRISPR CAGCGGCCCCTATAAACCGA AGG (reversed) Intronic
1069739951 10:70681112-70681134 CAGCCTCCCCTTTAAACCGTGGG - Intronic
1070417585 10:76205052-76205074 CAGAGGCCCCTAGCAACCGTGGG + Intronic
1076894946 10:133306280-133306302 CAGCGGCCCCTTCAAATCCAAGG + Intronic
1088500581 11:110478583-110478605 CAGCGCCCCCTATAGCCTGAAGG - Intergenic
1133005994 16:2882367-2882389 CAGCGGCCGCTTTAGAGCGAGGG + Intergenic
1145313814 17:21716606-21716628 CAGCAGCCACTAGAAACTGAAGG + Intergenic
1151577222 17:74958849-74958871 CAGCTGCCCCAATAACCCGGGGG - Intronic
1152279259 17:79375741-79375763 CAGCGGCCCCTTTCAAAGGAGGG - Intronic
1167514557 19:49915578-49915600 CAGCAGCCACTAGAAACCAATGG + Intronic
938791901 2:134683914-134683936 CAGAGGCCTCTATAAATTGAGGG - Intronic
1175428837 20:58889081-58889103 CAGCGGCCCCTATAAACCGAAGG - Intronic
1182309601 22:29395190-29395212 CAGCGGCCCCTGTGAAAGGATGG - Intronic
1184769261 22:46588249-46588271 CAGCGTCCCCCACAACCCGATGG + Intronic
978839510 4:113193431-113193453 CAGCGGCTTCTCTAAACCAAGGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
1029272519 7:99385573-99385595 CTGCTGCCCCTCTAAACTGAGGG + Intronic
1053392642 9:37746625-37746647 TAGCAGCCTCTATAAACTGATGG - Exonic
1191044800 X:56124535-56124557 CAGCTGCCTTTATAAACCGTAGG + Intergenic