ID: 1175429126

View in Genome Browser
Species Human (GRCh38)
Location 20:58890317-58890339
Sequence CCCGGCGGCGGCGCCCTCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175429126_1175429135 -5 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429135 20:58890335-58890357 CCGGGGGCACGAGTAGGGCCTGG No data
1175429126_1175429141 26 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429141 20:58890366-58890388 GGACACGGACTCGAGCGACGAGG No data
1175429126_1175429138 5 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429138 20:58890345-58890367 GAGTAGGGCCTGGGCTGACTGGG No data
1175429126_1175429139 11 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429139 20:58890351-58890373 GGCCTGGGCTGACTGGGACACGG No data
1175429126_1175429136 -4 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429136 20:58890336-58890358 CGGGGGCACGAGTAGGGCCTGGG No data
1175429126_1175429137 4 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429137 20:58890344-58890366 CGAGTAGGGCCTGGGCTGACTGG No data
1175429126_1175429132 -10 Left 1175429126 20:58890317-58890339 CCGAGGAGGGCGCCGCCGCCGGG No data
Right 1175429132 20:58890330-58890352 CGCCGCCGGGGGCACGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175429126 Original CRISPR CCCGGCGGCGGCGCCCTCCT CGG (reversed) Intronic