ID: 1175432188

View in Genome Browser
Species Human (GRCh38)
Location 20:58913237-58913259
Sequence CACCTGGCTGTGGAATCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175432188_1175432198 14 Left 1175432188 20:58913237-58913259 CCATGGGATTCCACAGCCAGGTG No data
Right 1175432198 20:58913274-58913296 CTTCCCACAGACCGTGGCACTGG No data
1175432188_1175432196 8 Left 1175432188 20:58913237-58913259 CCATGGGATTCCACAGCCAGGTG No data
Right 1175432196 20:58913268-58913290 GGGCCTCTTCCCACAGACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175432188 Original CRISPR CACCTGGCTGTGGAATCCCA TGG (reversed) Intergenic
No off target data available for this crispr