ID: 1175433715

View in Genome Browser
Species Human (GRCh38)
Location 20:58927650-58927672
Sequence CCCTGCCATATGGGGTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175433715_1175433724 10 Left 1175433715 20:58927650-58927672 CCACCTAACCCCATATGGCAGGG No data
Right 1175433724 20:58927683-58927705 CTAGCATGTGGCAGCAGGAGAGG No data
1175433715_1175433721 -2 Left 1175433715 20:58927650-58927672 CCACCTAACCCCATATGGCAGGG No data
Right 1175433721 20:58927671-58927693 GGAAGTTCCATTCTAGCATGTGG No data
1175433715_1175433725 18 Left 1175433715 20:58927650-58927672 CCACCTAACCCCATATGGCAGGG No data
Right 1175433725 20:58927691-58927713 TGGCAGCAGGAGAGGAAAGCTGG No data
1175433715_1175433723 5 Left 1175433715 20:58927650-58927672 CCACCTAACCCCATATGGCAGGG No data
Right 1175433723 20:58927678-58927700 CCATTCTAGCATGTGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175433715 Original CRISPR CCCTGCCATATGGGGTTAGG TGG (reversed) Intergenic
No off target data available for this crispr